معلومة

9.5C: استواء الأنسجة في الفيروسات الحيوانية - علم الأحياء

9.5C: استواء الأنسجة في الفيروسات الحيوانية - علم الأحياء



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

يشير مصطلح المضيف المداري إلى الطريقة التي تحدد بها الفيروسات / مسببات الأمراض الخلايا التي تصاب بمسببات مرضية معينة.

أهداف التعلم

  • اشرح المدارية الفيروسية

النقاط الرئيسية

  • يجب أن ترتبط الفيروسات بمستقبلات معينة على سطح الخلية من أجل الدخول إلى الخلية.
  • إذا كانت الخلية لا تعبر عن هذه المستقبلات ، فلن يتمكن الفيروس عادة من إصابتها بالعدوى.
  • في علم الفيروسات ، توزع الأنسجة هي خلايا وأنسجة مضيف تدعم نمو فيروس أو بكتيريا معينة. تمتلك بعض الفيروسات انتفاخًا واسعًا للأنسجة ويمكن أن تصيب أنواعًا عديدة من الخلايا والأنسجة. قد تصيب فيروسات أخرى نسيجًا واحدًا بشكل أساسي.

الشروط الاساسية

  • الخلايا الجذعية: أي خلية ، لها عمليات متفرعة ، تشكل جزءًا من الجهاز المناعي للثدييات.
  • الضامة: خلية دم بيضاء تبلعم حطام الخلايا النخرية والمواد الغريبة ، بما في ذلك الفيروسات والبكتيريا وحبر الوشم. يقدم مستضدات أجنبية على معقد التوافق النسيجي الكبير II إلى الخلايا الليمفاوية. جزء من الجهاز المناعي الفطري.

المدارية هي ظاهرة بيولوجية تشير إلى نمو أو تحول حركة كائن حي استجابةً لمحفز بيئي. في المناطق المدارية ، تعتمد هذه الاستجابة على اتجاه التحفيز (على عكس الحركات اللاذعة التي هي استجابات غير اتجاهية). تؤثر الفيروسات ومسببات الأمراض الأخرى أيضًا على ما يسمى "انتواء العائل" أو "انتواء الخلية". تشير الحالة المدارية إلى الطريقة التي تطورت بها الفيروسات / مسببات الأمراض المختلفة لتستهدف بشكل تفضيلي أنواع مضيفة معينة أو أنواع خلايا معينة داخل تلك الأنواع.

المدارية المضيفة هو الاسم الذي يطلق على عملية الانتواء التي تحدد الخلايا التي يمكن أن تصاب بالعدوى من قبل العامل الممرض. يتم تحديد المدارية المضيفة بواسطة معقدات المستقبلات الكيميائية الحيوية الموجودة على أسطح الخلايا التي تكون متسامحة أو غير مسموح بها في الالتحام أو التعلق بالفيروسات المختلفة.

تحدد عوامل مختلفة قدرة العامل الممرض على إصابة خلية معينة. على سبيل المثال ، يجب أن ترتبط الفيروسات بمستقبلات معينة على سطح الخلية للدخول إلى الخلية. إذا كانت الخلية لا تعبر عن هذه المستقبلات ، فلن يتمكن الفيروس عادة من إصابتها بالعدوى. يتم تحديد الانتفاخ الفيروسي من خلال مزيج من القابلية للإصابة والسماح: يجب أن تكون الخلية المضيفة متساهلة (تسمح بدخول الفيروس) وقابلة للتأثر (تمتلك تكملة المستقبلات اللازمة لدخول الفيروس) للفيروس لتأسيس العدوى. مثال على ذلك هو فيروس HIV ، الذي يُظهر الانتواء للخلايا المناعية المرتبطة بـ CD4 (مثل الخلايا التائية المساعدة ، أو الضامة ، أو الخلايا المتغصنة). تعبر هذه الخلايا عن مستقبل CD4 ، والذي يمكن لفيروس HIV الارتباط به ، من خلال بروتينات gp120 و gp41 الموجودة على سطحه.

في علم الفيروسات ، توزع الأنسجة هي خلايا وأنسجة مضيف تدعم نمو فيروس أو بكتيريا معينة. قد تصيب فيروسات أخرى نسيجًا واحدًا بشكل أساسي.

تشمل العوامل التي تؤثر على انتفاخ الأنسجة الفيروسية ما يلي: 1) وجود مستقبلات خلوية تسمح بدخول الفيروس ، 2) توافر عوامل النسخ المتضمنة في تكاثر الفيروس ، 3) الطبيعة الجزيئية للتروبوجين الفيروسي ، و 4) المستقبلات الخلوية هي البروتينات الموجودة في خلية أو سطح فيروسي.

تشبه هذه المستقبلات مفاتيح تسمح للخلية الفيروسية بالاندماج مع خلية أو ربط نفسها بالخلية. الطريقة التي يتم بها الحصول على هذه البروتينات هي من خلال عملية مماثلة لتلك الخاصة بدورة العدوى.


نظام توصيل أكسيد النيتريك وطرق استخدامه

توفر تجسيدات الكشف الحالي أنظمة وأجهزة لإيصال أكسيد النيتروز الغازي (gNO) تحت معاملات علاجية لتقليل العدوى في موضوع ما. تشتمل بعض النماذج على أجهزة وأنظمة لتوصيل gNO المضغوط لتقليل الحمل الحيوي وتعزيز التئام جروح الأشخاص الذين يعانون من حالات مرضية مختلفة ، بما في ذلك عدوى الجلد والأنسجة الرخوة (SSTIs) والتهاب العظم والنقي. في بعض النماذج ، يوفر الكشف الحالي أجهزة محمولة لالتئام الجروح لتوصيل gNO المضغوط إلى موقع الجرح لمعالجة حالات المرض المختلفة في الموضوع.

يدعي التطبيق الفوري الاستفادة من خدمة طلب براءات الاختراع المؤقتة الأمريكية. رقم 62 / 079،461 ، تم إيداعه في 13 تشرين الثاني (نوفمبر) 2014. هذا التطبيق مدرج هنا بالإشارة في مجمله لجميع الأغراض.

بيان بشأن البحث الممول من الاتحاد

تم دعم النماذج التي تم الكشف عنها هنا جزئيًا بواسطة وكالة مشاريع الأبحاث الدفاعية المتقدمة (DARPA) ، رقم منحة DARPA HR 0011-11-1-0006. الحكومة لديها حقوق معينة لهذا الاختراع.

توفر تجسيدات الكشف الحالي أنظمة وأجهزة لإيصال أكسيد النيتروز الغازي (gNO) تحت معلمات علاجية لتقليل العدوى المستهدفة في موضوع ما. تشتمل بعض النماذج على أجهزة وأنظمة لتوصيل gNO المضغوط لتقليل الحمل الحيوي وتعزيز الشفاء في جروح الشخص الذي يعاني من حالة صحية واحدة أو أكثر ، بما في ذلك ، على سبيل المثال لا الحصر ، عدوى الجلد والأنسجة الرخوة (SSTIs) و / أو التهاب العظم والنقي. تتعلق بعض التجسيدات التي تم الكشف عنها هنا بتقليل العدوى الممرضة في الأنسجة الرخوة لموضوع ما من أجل تعزيز التئام الجروح في الجروح المستمرة أو المزمنة.

أكسيد النيتريك (NO) هو مرسال جزيء صغير في كل مكان يشارك في العديد من العمليات المرضية والفسيولوجية. يلعب NO أدوارًا مهمة في مسارات نقل الإشارات الوعائية والعصبية ، وانقباض العضلات الملساء ، والطاقة الحيوية ، والتصاق الصفائح الدموية وتجميعها ، والمناعة ، وتنظيم موت الخلايا. لا يوجد نقص في العديد من العمليات المرضية الفيزيولوجية مثل ارتفاع ضغط الدم واختلال وظائف القلب والأوعية الدموية والتنكس العصبي والتهاب المفاصل والربو والصدمة الإنتانية. NO هو أحد جزيئات الإشارات الغازية القليلة المعروفة وهو أيضًا استثنائي بسبب حقيقة أنه غاز جذري. إنه منتج ثانوي معروف في جميع أنواع الكائنات الحية تقريبًا ، بدءًا من البكتيريا إلى النباتات والفطريات والخلايا الحيوانية.

هناك العديد من الآليات التي ثبت من خلالها أن أكسيد النيتروجين يؤثر على بيولوجيا الخلايا الحية. وتشمل هذه أكسدة البروتينات المحتوية على الحديد مثل اختزال الريبونوكليوتيد والأكونيتاز ، وتفعيل محلقة الجوانيلات القابلة للذوبان ، و ribosylation البروتينات ADP ، و nitrosylation البروتين ، وتفعيل عامل تنظيم الحديد. تم إثبات أن NO أيضًا ينشط NF-B في الخلايا أحادية النواة في الدم المحيطي ، وهو عامل نسخ مهم في التعبير الجيني لـ iNOS استجابةً للالتهاب. بالإضافة إلى ذلك ، أثناء الاستجابة المناعية ، يتم إفراز أكسيد النيتروجين كجذور حرة وهو سام للعديد من البكتيريا والطفيليات داخل الخلايا. يتسبب أكسيد النيتروجين في تلف الحمض النووي وتدهور مراكز كبريت الحديد إلى أيونات الحديد ومركبات نيتروزيل الحديد.

لا يشكل إعطاء أكسيد النيتروجين الخارجي طريقة قوية لتكملة أكسيد النيتروجين عندما لا يستطيع الشخص توليد ما يكفي للوظائف البيولوجية الطبيعية ، بل إنه يوفر أيضًا وسيلة لتسريع التئام الجروح وتقليل العبء الحيوي في الموضوع. يلعب NO الذي ينتجه كل من iNOS و eNOS العديد من الأدوار المهمة في التئام الجروح ، بدءًا من مرحلة الالتهاب وحتى إعادة تشكيل الندبة. على وجه الخصوص ، لا يمارس NO تأثيرات تثبيط الخلايا ، والتأثير الكيميائي ، والتوسع الوعائي أثناء إصلاح الجرح المبكر ، وينظم تكاثر وتمايز العديد من أنواع الخلايا ، وينظم ترسب الكولاجين وتكوين الأوعية ، ويؤثر على تقلص الجرح. ومع ذلك ، فإن التوقيت والتركيز والضغط وموقع إعطاء NO كلها عوامل حرجة غير مفهومة جيدًا تؤثر على قدرة NO على تسهيل إصلاح الجرح.

توفر تجسيدات الكشف الحالي أنظمة وأجهزة لإيصال أكسيد النيتروز الغازي (gNO) تحت معلمات علاجية لتقليل العدوى المستهدفة في موضوع ما. تشتمل بعض النماذج على أجهزة وأنظمة لتوصيل gNO المضغوط لتقليل الحمل الحيوي وتعزيز الشفاء في جروح الشخص الذي يعاني من حالة صحية واحدة أو أكثر ، بما في ذلك ، على سبيل المثال لا الحصر ، عدوى الجلد والأنسجة الرخوة (SSTIs) و / أو التهاب العظم والنقي. تتعلق بعض التجسيدات التي تم الكشف عنها هنا بتقليل العدوى الممرضة في الأنسجة الرخوة لموضوع ما من أجل تعزيز التئام الجروح في الجروح المستمرة أو المزمنة.

توفر تجسيدات الكشف الحالي جهاز توصيل أكسيد النيتريك الغازي (gNO) لتوصيل gNO المضغوط إلى موضوع ما. في بعض النماذج ، يشتمل الجهاز على مصدر gNO المقترن وظيفيًا بوحدة واجهة الموضوع ، ومنظم تدفق الغاز الذي يقيس معدل تدفق gNO ومنظم ضغط الغاز الذي يقيس ضغط gNO حيث يتم تسليم gNO من خلال واجهة الموضوع وحدة للموضوع ، حيث يعالج gNO عدوى في الموضوع.

في تجسيدات معينة ، يكون ضغط gNO المسلم للموضوع من حوالي 0.15 ATM إلى حوالي 1.0 ATM.

في نماذج أخرى ، يتم تسليم gNO للموضوع بمعدل تدفق من حوالي 0.1 لتر / دقيقة إلى حوالي 1.0 لتر / دقيقة.

في بعض النماذج ، يكون تركيز gNO المسلم للموضوع حوالي 1.0٪.

في نماذج معينة ، يتم تسليم gNO للموضوع بشكل مستمر لمدة 30 دقيقة إلى حوالي 120 دقيقة.

في تجسيدات أخرى أيضًا ، يمكن أن يشتمل الجهاز أيضًا على واحد أو أكثر من مستشعرات أكسيد النيتريك.

في بعض النماذج ، يمكن أن يشتمل الجهاز أيضًا على واحد أو أكثر من مستشعرات الأكسجين.

في نموذج آخر أيضًا ، يمكن أن يشتمل الجهاز أيضًا على آلية شطف الغاز لتقليل حدوث أو منع تعرض الموضوع لـ gNO عند إزالة وحدة واجهة الموضوع.

في بعض النماذج ، تشتمل وحدة واجهة الموضوع على مخرج غاز لضمان التدفق المستمر لـ gNO والتعرض المستمر لـ gNO للموضوع.

في تجسيدات معينة ، تشتمل وحدة واجهة الموضوع على آلية ربط للحفاظ على ختم على الموضوع (أو منطقة من ملحق الموضوع) أثناء تسليم غاز gNO.

في نماذج أخرى ، تشمل معالجة العدوى في الموضوع تقليل الحمل الحيوي في الجرح الموجود في الموضوع.

في بعض النماذج ، يمكن أن يشمل علاج العدوى في الموضوع تقليل واحد أو أكثر من الأعراض المرتبطة بالعدوى.

في تجسيدات معينة ، يتضمن علاج الموضوع تقليل خطر الإصابة بعدوى واحد أو أكثر من الكائنات المسببة للأمراض في الموضوع عن طريق تعريضهم مسبقًا لـ GNO قبل ظهور العدوى في موقع الجرح. وفقًا لهذه النماذج ، يمكن معالجة الموضوع باستخدام gNO عند تقديم جرح جديد.

في تجسيدات أخرى ، تشمل العدوى منطقة من جسم الشخص المصاب مصابة على الأقل بعامل ممرض واحد مختار من المجموعة التي تتكون من بكتيريا ، وفيروس ، وفطر ، وطفيلي ، ومفصليات الأرجل ، وبكتيريا مقاومة للمضادات الحيوية ، أو مزيج منها.

في بعض النماذج ، تكون العدوى عبارة عن آفة ، بما في ذلك ، على سبيل المثال لا الحصر ، جرح جراحي ، وجرح رض ، وحرق ، وخراج ، وتقرن سفعي ، وجُدَرَة ، وندبة ، وسرطان الجلد ومجموعة منها.

تشتمل نماذج الكشف الحالي أيضًا على نظام توصيل أكسيد النيتريك الغازي (gNO) لتوصيل gNO المضغوط إلى موضوع ما. في بعض النماذج ، يشتمل النظام على مصدر gNO المقترن وظيفيًا بوحدة واجهة الموضوع ، ومنظم تدفق الغاز الذي يقيس معدل تدفق gNO ومنظم ضغط الغاز الذي يقيس ضغط gNO حيث يتم تسليم gNO من خلال واجهة الموضوع وحدة للموضوع ، حيث يعالج gNO أو يمنع ظهور العدوى في الموضوع أو يقلل من ظهورها.

في نماذج معينة وفقًا للأنظمة التي تم الكشف عنها هنا ، يكون ضغط gNO الذي يتم تسليمه للموضوع من حوالي 0.15 ATM إلى حوالي 1.0 ATM ، حيث يكون معدل تدفق gNO الذي يتم تسليمه للموضوع من حوالي 0.1 لتر / دقيقة إلى حوالي 1.0 لتر / دقيقة ، وحيث يكون تركيز gNO المسلم للموضوع حوالي 1.0٪.

في نماذج أخرى ، يشتمل النظام الذي تم الكشف عنه هنا على واحد أو أكثر من أجهزة استشعار الأكسجين ، أو أكسيد النيتريك ، أو مستشعر ثاني أكسيد النيتريك.

في تجسيدات معينة ، تشتمل معالجة عدوى في الموضوع باستخدام نظام تم الكشف عنه هنا على تقليل الحمل الحيوي (على سبيل المثال ، الكائنات المسببة للأمراض) في جرح في الموضوع.

في نماذج أخرى ، يمكن أن يشتمل النظام الذي تم الكشف عنه في هذه الوثيقة أيضًا على آلية شطف الغاز لمنع الموضوع من التعرض لـ gNO عند إزالة وحدة واجهة الموضوع.

في نماذج معينة ، تشتمل وحدة واجهة الموضوع على مخرج غاز لضمان التدفق المستمر لـ gNO والتعرض المستمر لـ gNO للموضوع.

تتضمن تجسيدات الكشف الحالي أيضًا طريقة لعلاج جرح في موضوع ما. في بعض النماذج ، تتضمن الطريقة إرفاق وحدة واجهة الموضوع بموقع الجرح على الموضوع ، ووحدة واجهة الموضوع مقترنة وظيفيًا بمصدر أكسيد النيتريك الغازي (gNO) ، وتقديم كمية فعالة من gNO إلى موقع الجرح على الموضوع ، حيث يعالج gNO موقع الجرح في الموضوع.

في تجسيدات معينة ، يكون ضغط gNO المسلم إلى موقع الجرح على الموضوع من حوالي 0.15 ATM إلى حوالي 1.0 ATM ، حيث يكون معدل تدفق gNO الذي يتم تسليمه إلى موقع الجرح على هذا الموضوع من حوالي 0.1 لتر / دقيقة إلى حوالي 1.0 لتر / دقيقة ، وحيث يكون تركيز gNO الذي يتم تسليمه إلى موقع الجرح على الجسم حوالي 1.0٪.

في بعض النماذج ، يتم تسليم gNO إلى موقع الجرح على الموضوع بشكل مستمر لمدة 30 دقيقة إلى حوالي 120 دقيقة.

في نماذج أخرى ، تشتمل معالجة موقع الجرح على تقليل الحِمل الحيوي في العدوى في موقع الجرح.

في نماذج معينة ، تشتمل معالجة موقع الجرح على تقليل خطر الإصابة بعدوى في موقع الجرح.

كما هو مستخدم هنا ، يمكن أن تتضمن المصطلحات "موضوع" و "مستخدم" و / أو "مريض" البشر والحيوانات الأخرى أو الثدييات التي تحتاج إلى علاج وقادرة على استخدام الأجهزة والأنظمة أو المساعدة في استخدامها كما هو موصوف هنا. بالإضافة إلى ذلك ، يمكن أن تتضمن المصطلحات "موضوع" و "مستخدم" و / أو "مريض" البشر والثدييات الأخرى التي يتم علاجها في أي نوع من البيئات مثل البيئة السريرية ، والإعداد غير السريري ، والإعداد التجريبي ، وما إلى ذلك. في النماذج ، قد يكون المستخدم غير قادر على التشغيل الفعال لأنظمة تسليم gNO المختلفة وقد يحتاج إلى مساعدة طرف ثالث. على هذا النحو ، يمكن أن تشمل الوظائف التي يؤديها "المستخدم" الوظائف التي يؤديها موفر خارجي ، مثل مقدم الرعاية الصحية و / أو شخص مخول آخر مرتبط بالمستخدم.

يتم استخدام المصطلحات "تحديد" و "احسب" و "احسب" والاختلافات منها ، كما هو مستخدم هنا ، بالتبادل وتشمل أي نوع من المنهجية أو العملية أو العملية الرياضية أو التقنية.

وتجدر الإشارة إلى أن المصطلح "a" أو "an" يشير إلى واحد أو أكثر من هذا الكيان. على هذا النحو ، المصطلحات "a" (أو "an") ، "واحد أو أكثر" و "واحد على الأقل" يمكن استخدامها بالتبادل هنا. وتجدر الإشارة أيضًا إلى أن المصطلحات "تشتمل على" و "تشمل" و "تمتلك" يمكن استخدامها بالتبادل.

كما هو مستخدم هنا ، "واحد على الأقل" ، "واحد أو أكثر" ، و "و / أو" عبارة عن تعبيرات ذات نهاية مفتوحة تكون مرتبطة ومفصلة في العملية. على سبيل المثال ، كل تعبير من التعبيرات "واحد على الأقل من A و B و C" ، "واحد على الأقل من A أو B أو C" ، "واحد أو أكثر من A و B و C" ، "واحد أو أكثر من A أو B أو C "و" A و B و / أو C "تعني A بمفرده ، و B بمفرده ، و C بمفرده ، و A و B معًا ، و A و C معًا ، و B و C معًا ، أو A و B و C معًا سويا. عندما يشير كل واحد من A و B و C في التعبيرات أعلاه إلى عنصر ، مثل X و Y و Z أو فئة من العناصر ، مثل X1-Xn و Y1-Ym و Z1-Zo ، فإن العبارة المقصود بالإشارة إلى عنصر واحد محدد من X و Y و Z ، وهي مجموعة من العناصر المختارة من نفس الفئة (على سبيل المثال ، X1 و X2) بالإضافة إلى مجموعة من العناصر المختارة من فئتين أو أكثر (على سبيل المثال ، Y1 و Zo).

يجب إعطاء المصطلح "يعني" كما هو مستخدم هنا أوسع تفسير ممكن وفقًا لـ 35 U. § 112 (و). وبناءً على ذلك ، فإن المطالبة التي تتضمن مصطلح "الوسائل" يجب أن تغطي جميع الهياكل أو المواد أو الأفعال المنصوص عليها هنا ، وجميع ما يعادلها. علاوة على ذلك ، يجب أن تشمل الهياكل أو المواد أو الأعمال وما يعادلها كل تلك الموصوفة في الملخص ، ووصفًا موجزًا ​​للرسومات ، ووصفًا تفصيليًا ، وملخصًا ، وعناصر الحماية نفسها.

يجب أن يكون مفهوماً أن كل حد رقمي أقصى تم تقديمه خلال هذا الكشف يعتبر أنه يشمل كل حد رقمي أدنى كبديل ، كما لو كانت هذه القيود العددية الأقل مكتوبة هنا صراحةً. يُنظر إلى كل حد أدنى من القيود الرقمية المعطاة خلال هذا الكشف على أنه يشمل كل حد رقمي أعلى كبديل ، كما لو كانت هذه القيود الرقمية الأعلى مكتوبة هنا صراحةً. يُعتبر كل نطاق عددي تم تقديمه خلال هذا الكشف ليشمل كل نطاق رقمي أضيق يقع ضمن هذا النطاق العددي الأوسع ، كما لو أن هذه النطاقات الرقمية الأضيق قد تمت كتابتها جميعًا صراحةً هنا.

ما سبق هو ملخص مبسط للإفصاح لتوفير فهم لبعض جوانب الإفصاح. هذا الملخص ليس نظرة عامة شاملة أو شاملة عن الكشف وجوانبه وتجسيداته وتكويناته المختلفة. لا يقصد به تحديد العناصر الرئيسية أو الحاسمة للإفصاح ولا تحديد نطاق الكشف ولكن تقديم مفاهيم مختارة للإفصاح في شكل مبسط كمقدمة للوصف الأكثر تفصيلاً المعروض أدناه. كما سيكون موضع تقدير ، من الممكن استخدام جوانب وتجسيدات وتكوينات الكشف الأخرى ، وحدها أو مجتمعة ، واحدة أو أكثر من الميزات الموضحة أعلاه أو الموضحة بالتفصيل أدناه.

وصف مختصر للرسومات

تم دمج الرسومات المصاحبة في المواصفات وتشكل جزءًا منها لتوضيح عدة أمثلة على الكشف الحالي. تشرح هذه الرسومات مع الوصف مبادئ الإفصاح. توضح الرسومات ببساطة الأمثلة المفضلة والبديلة لكيفية إجراء الكشف واستخدامه ولا يجب تفسيره على أنه يقصر الإفصاح على الأمثلة الموضحة والموصوفة فقط. ستظهر الميزات والمزايا الإضافية من الوصف التالي ، الأكثر تفصيلاً ، للجوانب المختلفة ، والتجسيدات ، والتكوينات الخاصة بالكشف ، كما هو موضح بالرسومات المشار إليها أدناه.

تين. يمثل الشكل 1 تمثيلاً لجهاز توصيل أكسيد النيتريك الغازي المحمول (gNO) ، وفقًا لتجسيد الكشف الحالي.

تين. 2A-2C عبارة عن تمثيلات لثلاث وحدات واجهة موضوعية تقترن بجهاز توصيل NO ، وفقًا لنماذج الكشف الحالي.

تين.3 عبارة عن رسم تمثيلي لجهاز توصيل gNO محمول لا يتطلب مشعبًا ، وفقًا لتجسيد الكشف الحالي.

تين. الشكل 4 هو رسم بياني يوضح تأثيرات معالجة GNO على الحِمل الحيوي بعد ثلاث ساعات من العدوى البكتيرية ، وفقًا لتجسيد الكشف الحالي.

تين. 5A-5C عبارة عن أقسام نسيجية تمثيلية ملطخة للكشف عن وجود البكتيريا على الأنسجة المعالجة وغير المعالجة ، وفقًا لنماذج الكشف الحالي. (الشكل 5 أ: الأنسجة المصابة وغير المصابة بالشكل 5 ب: الأنسجة المصابة والمصابة لمدة 3 ساعات والشكل 5 ج: الأنسجة المصابة والمصابة لمدة 24 ساعة)

تين. 6A-6F عبارة عن أقسام نسيجية تمثيلية ملطخة للكشف عن مكونات الغشاء الحيوي البكتيري ، وفقًا لتجسيد الكشف الحالي. (الشكل 6 أ ملطخ بالهيماتوكسيلين ويوزين الشكل 6 ب ملطخ بتفاعل Feulgen الشكل 6C ملطخ بأحمر الكونغو المعدل. ملطخ بالكلسوفلور)

في حين أن الإفصاح قابل للتغييرات المختلفة والأشكال البديلة ، فقد تم توضيح تجسيدات محددة على سبيل المثال في الرسومات وتم وصفها بالتفصيل أدناه. ومع ذلك ، فإن القصد هو عدم قصر الكشف على التجسيدات المحددة الموصوفة. على العكس من ذلك ، يهدف الإفصاح إلى تغطية جميع التعديلات والمكافئات والبدائل التي تقع ضمن نطاق الإفصاح و / أو المطالبات.

وصف مفصل

توفر تجسيدات الكشف الحالي أنظمة وأجهزة لإيصال أكسيد النيتروز الغازي (gNO) تحت معاملات علاجية لتقليل العدوى في موضوع ما. تشتمل بعض النماذج على أجهزة وأنظمة لتوصيل gNO المضغوط لتقليل الحمل الحيوي وتعزيز التئام جروح الأشخاص الذين يعانون من حالات مرضية مختلفة ، بما في ذلك عدوى الجلد والأنسجة الرخوة (SSTIs) والتهاب العظم والنقي.

تين. يمثل الشكل 1 تمثيلاً لجهاز توصيل gNO محمول ، وفقًا لتجسيد الكشف الحالي. يمكن أن يشتمل جهاز التوصيل المحمول NO الخاص بالكشف الحالي على مشعب 100 يتضمن منظم ضغط الغاز 105، منظم تدفق الغاز 110، ووحدة واجهة الموضوع. تسمح أجهزة وأنظمة توصيل gNO بنقل الجهاز بسهولة إلى أماكن مختلفة حيث لا يكون التدخل العلاجي مناسبًا لظروف المستشفى الداخلية. كما هو موضح في FIG. 1 ، فتحات الغاز 100 المستخدمة مع أجهزة توصيل gNO وأنظمة الكشف الحالي يمكن أن تتضمن ميزات مختلفة للتحكم في توصيل الغاز إلى موضوع ما (على سبيل المثال ، مشعبات الغاز من ALICAT SCIENTIFIC). على سبيل المثال ، يمكن أن تشتمل مشعبات الغاز المستخدمة مع أجهزة توصيل NO المحمولة وأنظمة الكشف الحالي على منفذ لإدخال مصدر طاقة 115 و / أو منفذ لإدخال وحدة أو أكثر من وحدات البطاريات القابلة لإعادة الشحن (غير موضحة) ، وقراءات رقمية متنوعة لتركيز الغاز والضغط 120، مداخل غاز مختلفة 125 ومنافذ البيع 130، وأجهزة استشعار مختلفة لتركيز الغاز 135. يمكن أن تقترن مشعبات الغاز المستخدمة مع أجهزة توصيل NO المحمولة وأنظمة الكشف الحالي وظيفيًا بوحدة واجهة الموضوع لتسهيل إدارة NO إلى موضوع ما. يمكن استخدام أنواع ونماذج مختلفة من مشعبات الغاز لتوصيل gNO المضغوط إلى موضوع ما ، كما يمكن التعرف عليه بواسطة مهارة واحدة أو مهارة عادية في الفن بناءً على الكشف الحالي.

في بعض النماذج ، تشتمل أجهزة توصيل gNO المحمولة للكشف الحالي على مصدر لـ gNO ، مثل حاوية تخزين gNO التي تضم gNO قبل التسليم إلى موضوع ما. يمكن أن تكون حاوية تخزين gNO أي خزان أو أسطوانة مناسبة تحتوي على مادة gNO مضغوطة من الدرجة الطبية لتسليمها إلى موضوع ما. يمكن أيضًا تجهيز أسطوانات تخزين gNO المناسبة بمقاييس أو منظمات ضغط ، ومقاييس تدفق أو منظمات ، ومقابض ضبط لضبط كل من ضغط المخرج ومعدلات التدفق ، ومداخل / مخارج الغاز ، وما شابه ذلك. في بعض الجوانب ، يمكن أن تتضمن أسطوانة gNO كمية محددة من gNO (على سبيل المثال ، لترات من gNO) ، بحيث يشكل تسليم gNO إلى موضوع له حالة معينة معالجة واحدة. على سبيل المثال ، يمكن أن تحتوي أسطوانة تخزين gNO على ما يقرب من 9.0 لترات من gNO بحيث عندما يتم تسليمها إلى موضوع لمدة 90 دقيقة متصلة بمعدل تدفق 0.1 لتر في الدقيقة (LPM) ، سيتم استنفاد gNO. في طريقة التشغيل هذه ، يمكن أن تعمل أسطوانة تخزين gNO كميزة أمان لمنع التعرض المفرط لـ gNO للموضوع.

في بعض النماذج ، يكون gNO المسلم إلى موضوع ما جزءًا من خليط غاز به تركيز NO يتراوح من حوالي 1 جزء في المليون إلى حوالي 1500 جزء في المليون ، من حوالي 1000 جزء في المليون إلى حوالي 5000 جزء في المليون ، من حوالي 4000 جزء في المليون إلى حوالي 10000 جزء في المليون ، من حوالي 9000 جزء في المليون إلى حوالي 16000 جزء في المليون ، من حوالي 15000 جزء في المليون إلى حوالي 22000 جزء في المليون ، من حوالي 21000 جزء في المليون إلى حوالي 28000 جزء في المليون ، من حوالي 27000 جزء في المليون إلى حوالي 34000 جزء في المليون ، ومن حوالي 33000 جزء في المليون إلى حوالي 40.000 جزء في المليون. في بعض الجوانب ، يكون gNO المسلم للموضوع 10000 جزء في المليون ، أو حوالي 1.0٪ من خليط الغاز (1 جزء في المليون حوالي 0.0001٪).

في بعض النماذج ، يكون جهاز التوصيل NO مجهزًا لتوصيل gNO تحت معلمات مختلفة ، بما في ذلك توصيل gNO عند ضغوط مختلفة. في بعض الجوانب ، يمكن تسليم gNO لموضوع تحت ضغوط في أي مكان بين حوالي 0 أجواء (ATM) إلى حوالي 1 ATM (أي الضغط داخل وحدة واجهة الموضوع). تسليم gNO لموضوع في هذا النطاق مستقل عن ، بالإضافة إلى ضغط البيئة الخارجية (مثل الضغط الجوي). كما يمكن التعرف عليه من قبل أحد المهارة العادية في الفن بناءً على الكشف الحالي ، يمكن التعبير عن وحدات الضغط باستخدام مقاييس مختلفة ، بما في ذلك أجهزة الصراف الآلي ، قوة رطل لكل بوصة مربعة (على سبيل المثال ، lbf / in 2 أو psi) ، بار ( على سبيل المثال ، Mbar ، kilobar ، millibar ، إلخ.) ، باسكال (على سبيل المثال ، Pa ، kPa ، MPa ، إلخ) و / أو torr (على سبيل المثال ، Torr ، mTorr ، إلخ). على سبيل المثال ، يمكن التعبير عن 1 ATM كـ 14.695 رطل لكل بوصة مربعة. في بعض جوانب الكشف الحالي ، يمكن قياس الضغط والتعبير عنه بزيادات هي أعشار و / أو مئات و / أو آلاف من هذه المقاييس المختلفة. في بعض الجوانب ، يتم تسليم gNO في نطاقات مختلفة. على سبيل المثال ، يمكن نقل غاز gNO عند الضغوط من حوالي 0 ATM إلى حوالي 1.0 ATM ، من حوالي 0 ATM إلى حوالي 0.9 ATM ، ومن حوالي 0 ATM إلى حوالي 0.8 ATM ، ومن حوالي 0 ATM إلى حوالي 0.7 ATM ، من حوالي 0 ATM إلى حوالي 0.6 ATM ، من حوالي 0 ATM إلى حوالي 0.5 ATM ، من حوالي 0 ATM إلى حوالي 0.4 ATM ، من حوالي 0 ATM إلى حوالي 0.3 ATM ، من حوالي 0 ATM إلى حوالي 0.2 ATM ، ومن حوالي 0 ATM إلى حوالي 0.1 ماكينة الصراف الآلي. في بعض الجوانب ، يمكن تسليم gNO عند ضغوط تتراوح من حوالي 0.1 ATM إلى حوالي 0.5 ATM ، ومن حوالي 0.15 ATM إلى حوالي 1.0 ATM ، ومن حوالي 0.15 ATM إلى حوالي 0.5 ATM ، ومن حوالي 0.15 ATM إلى حوالي 0.25 ATM ، ومن حوالي 0.25 ATM إلى حوالي 0.5 ATM. في بعض الجوانب ، يمكن تسليم gNO عند ضغوط تبلغ حوالي 0.1 ATM ، حوالي 0.15 ATM ، حوالي 0.2 ATM ، حوالي 0.25 ATM ، حوالي 0.3 ATM ، حوالي 0.35 ATM ، حوالي 0.4 ATM ، حوالي 0.45 ATM ، حوالي 0.5 ATM ، حوالي 0.55 ATM ، حوالي 0.6 ATM ، حوالي 0.65 ATM ، حوالي 0.7 ATM ، حوالي 0.75 ATM ، حوالي 0.8 ATM ، حوالي 0.85 ATM ، حوالي 0.9 ATM ، وحوالي 0.95 ATM.

تين. 2A-2B عبارة عن تمثيلات لوحدتين من واجهة الموضوع التي تقترن بجهاز توصيل NO ، وفقًا لتجسيد الكشف الحالي. وحدات واجهة الموضوع هي أجزاء من نظام التوصيل NO التي يتم وضعها مباشرة على الموضوع ، على سبيل المثال ، حول موقع الجرح ، بحيث لا يتم تسليم NO إلى موقع الجرح. تتضمن وحدة واجهة الموضوع بشكل عام آلية إرفاق لتأمين وحدة واجهة الموضوع على الموضوع و / أو الحفاظ على أو إنشاء ختم على الموضوع. في بعض الجوانب ، كما هو موضح في FIG. 2A ، وحدة واجهة الموضوع 205 على شكل كوب ويتضمن أحزمة تثبيت 210 خفيفة وسهلة المعالجة ومصنوعة من مواد مناسبة للتثبيت على موضوع ما. في بعض الجوانب ، كما هو موضح في FIG. 2B ، وحدة واجهة الموضوع 215 أكثر صلابة ، ويتضمن وحدة تفريغ محيطية (غير موضحة) تساعد في إنشاء وصيانة مانع تسرب حول منفذ توصيل NO.

في جوانب أخرى ، كما هو موضح في FIG. 2C ، وحدة واجهة الموضوع 220 تم تكوينه ليلائم مساحة أكبر من ملحق الموضوع. وحدة واجهة الموضوع 220 يمكن أن يكون غلافًا شفافًا مرنًا يغطي ، على سبيل المثال ، قدم أو يد الشيء بالكامل. وحدة واجهة الموضوع 220 يمكن أيضًا أن يكون هيكلًا صلبًا يشبه الصندوق أو هيكلًا أسطوانيًا يحيط بمعظم ساق أو ذراع الشخص ، على سبيل المثال ، ويتم تكوينه لتشكيل ختم حول المنطقة الأقرب للساق أو الذراع. يمكن استخدام التكوينات الأخرى لوحدة واجهة الموضوع وآليات المرفقات من أجل تأمين وحدة واجهة الموضوع على الموضوع ولضمان التسليم الفعال لـ NO الموضوع. كما قد يتعرف عليه أحد المهارة العادية في الفن بناءً على الكشف الحالي ، تعتمد هذه التكوينات على عوامل مثل ، على سبيل المثال لا الحصر ، حجم موقع المعالجة ، وموقعه في الموضوع ، ونوع الإصابة ، و الاعجاب.

في بعض النماذج ، يمكن تكوين أجهزة وأنظمة توصيل gNO للكشف الحالي بحيث لا يكون مشعب الغاز مطلوبًا ، كما هو موضح في الشكل. 3. على سبيل المثال ، جهاز توصيل gNO 300 يمكن أن تتضمن مصدرًا لـ gNO 305 (على سبيل المثال ، أسطوانة أو خزان) مقترن بشكل مباشر ووظيفي بآليات لتنظيم ضغط GNO والتدفق إلى وحدة واجهة الموضوع ، مثل منظم ضغط الغاز 310 و / أو منظم تدفق الغاز 315. جهاز توصيل gNO 300 يمكن أن تتضمن أيضًا قراءات أو شاشات رقمية و / أو تمثيلية لتصور ضغط وتدفق gNO الذي يتم تسليمه إلى وحدة واجهة الموضوع (على سبيل المثال ، مقياس الضغط ، مقياس التدفق). جهاز توصيل gNO 300 يمكن أن تشتمل أيضًا على مقابض ضبط دقيقة و / أو خشنة لضبط ضغط وتدفق gNO الذي يتم توصيله. جهاز توصيل gNO 300 يمكن أن تشمل أيضًا مداخل الغاز 320 ومنافذ الغاز 325 إلى جانب منظمات الضغط والتدفق وكذلك مداخل الغاز 330 ومنافذ الغاز 335 إلى جانب وحدة واجهة الموضوع 340.

تجسيدات مختلفة لجهاز توصيل gNO 300 يمكن أن توفر مزايا إضافية تتمثل في عدم الحاجة إلى مشعب أو أي مكونات إلكترونية ، وبالتالي ، يمكن نشرها بسهولة أكبر في الحالات الطبية الطارئة. في بعض الجوانب ، يمكن أن تشتمل أسطوانة gNO المستخدمة مع أجهزة gNO هذه على كمية محددة من gNO (على سبيل المثال ، لترات من gNO) ، بحيث يشكل تسليم gNO لموضوع معالجة واحدة. على سبيل المثال ، يمكن أن تحتوي أسطوانة تخزين gNO على ما يقرب من 9.0 لترات من gNO بحيث يتم استنفاد gNO عند تسليمها إلى موضوع لمدة 90 دقيقة متصلة بمعدل تدفق 0.1 لتر في الدقيقة (LPM). في طريقة التشغيل هذه ، يمكن أن تعمل أسطوانة تخزين gNO كميزة أمان لمنع التعرض المفرط لـ gNO للموضوع.

يمكن تغليف وحدات واجهة الموضوع في الكشف الحالي بمواد تساعد على منع أو تقليل التلوث من الكائنات الحية الدقيقة والبكتيريا والفطريات والفيروسات وما شابه ذلك. يمكن أن تكون الطلاءات عوامل صيدلانية نشطة تقلل من نمو و / أو بقاء هذه الكائنات الدقيقة الضارة (على سبيل المثال ، المواد المضادة للبكتيريا) ، و / أو يمكن أن تعمل الطلاءات بشكل سلبي لمنع أو تقليل التلوث ، على سبيل المثال ، عن طريق منع التقيد بهذه الكائنات الحية الدقيقة. الكائنات الحية الدقيقة على الأسطح المختلفة لوحدات واجهة الموضوع (على سبيل المثال ، عوامل الترطيب).

تشمل المواد المناسبة التي يمكن استخدامها لبناء وحدات واجهة الموضوع في الكشف الحالي ، على سبيل المثال لا الحصر ، العديد من المواد البلاستيكية والبوليمرات ، مثل البوليسترين (PS) والبولي كربونات (PC) والأكريلونيتريل - البوتادين - الستايرين (ABS) ، بولي بيوتيلين تيريفثاليت (PBTP) ، ستايرين أكريلونيتريل (SAN) ، بولي أميد (PA) ، بوليوكسيميثيلين (POM) ، أكسيد البوليفينيل (PPO) ، PE ، PP ، PTFE والبوليمرات المتجانسة والبوليمرات المشتركة لهذه المواد البلاستيكية والمواد المماثلة المعروفة في الفن والقائمة على الكشف الحالي. يمكن أيضًا استخدام اللدائن في شكل معبأ أو مقوى بالألياف و / أو مقترن بأجزاء من معادن أو سبائك معدنية ، مثل الألومنيوم والتيتانيوم والصلب وتوليفات منها. يمكن أن تكون المواد المستخدمة في إنشاء وحدات واجهة الموضوع مغطاة بالأسطح ، على سبيل المثال بالدهانات أو الورنيش أو اللك. من الممكن أيضًا استخدام البلاستيك الملون ، على سبيل المثال الملون بأصباغ.

يمكن إنشاء العديد من وحدات واجهة الموضوع الأخرى ، اعتمادًا على خصائص موقع الجرح ، وموقع موقع الجرح ، وحالة الموضوع ، والبيئة التي سيتم فيها معالجة الموضوع ، وما شابه ذلك. في بعض الجوانب ، يمكن تكييف وحدات واجهة الموضوع المختلفة لاستخدام النموذج في موضوع ما ، ولكن في إعداد في المختبر ، لأغراض تجريبية (انظر ، على سبيل المثال ، الشكل 2C). على سبيل المثال ، يمكن وضع ساق أو ذراع اصطناعية في وحدة واجهة موضوعية محكمة الغلق على شكل أسطواني مهيأة لاستقبال الخلايا و / أو الأنسجة المستنبتة (على سبيل المثال ، أنسجة الجلد كاملة السماكة). يمكن استخدام هذه التكوينات لإجراء تجارب قبل استخدامها على موضوع حي فعلي.

مهما كان تكوين وحدة واجهة الموضوع ، فمن المفيد إنشاء والحفاظ على ختم على الموضوع بحيث يمكن إعطاء NO عند ضغوط مرتفعة بشكل كافٍ لتوفير فوائد علاجية للموضوع (على سبيل المثال ، تقليل العبء الحيوي ، وتقليل العدوى ، وتسريع التئام الجروح وما شابه ذلك). كما هو مستخدم هنا ، تشير الحمولة الحيوية بشكل عام إلى عدد البكتيريا أو مسببات الأمراض الأخرى الموجودة على السطح ، على سبيل المثال ، سطح النسيج أو الجرح (على سبيل المثال ، الجلد و / أو العظام). يرتبط تقليل الحمل الحيوي عمومًا بتقليل العدوى أو تقليلها ، بالإضافة إلى الأعراض المختلفة المصاحبة للعدوى (على سبيل المثال ، الألم ، التورم ، الاحمرار ، الرائحة الكريهة ، خروج الدم أو القيح ، إلخ). يميل تقليل العبء الحيوي وتقليل العدوى أيضًا إلى الارتباط مع التئام الجروح المتسارع وإصلاح الأنسجة ونمو الأنسجة السليمة. يمكن أن يؤدي تطبيق NO المضغوط لفترة زمنية معينة بمعدل تدفق معين إلى تقليل الحمل الحيوي في جرح موضوع ما ، مما يعزز بدوره الشفاء.

يمكن أن تتضمن أنظمة توصيل NO للإفصاح الحالي وحدات واجهة موضوعية لها القدرة على الحفاظ على ختم على موضوع ما عند إدارة NO بين حوالي 0.1 ATM (1.47 psi) إلى حوالي 1.0 ATM (14.695 psi). في بعض الجوانب ، فإن إعطاء NO عند ضغط يتراوح من حوالي 0.1 ATM (1.47 رطل / بوصة مربعة) إلى حوالي 0.25 ATM (3.674 رطل / بوصة مربعة) كافٍ لتأسيس والحفاظ على ختم على جرح الموضوع وتقليل الحمل الحيوي في الجرح ، وبالتالي تسريع الشفاء . في جوانب أخرى ، فإن إعطاء NO عند ضغط يتراوح من حوالي 0.1 ATM (1.47 رطل / بوصة مربعة) إلى حوالي 0.15 ATM (2.20 رطل / بوصة مربعة) كافٍ لتأسيس والحفاظ على ختم على جرح الموضوع وتقليل الحمل الحيوي في الجرح ، وبالتالي الإسراع شفاء. إن إعطاء NO في نطاقات الضغط هذه كافٍ لتقليل العبء الحيوي دون المساس بشكل كبير بقدرة الخلايا والأنسجة في الجسم.

في بعض النماذج ، يمكن استخدام أنظمة توصيل NO للكشف الحالي لإعطاء NO إلى موقع جرح الشخص بمعدل تدفق معين. كما يمكن التعرف عليه من قبل أحد المهارة العادية في الفن بناءً على الكشف الحالي ، يمكن التعبير عن وحدات معدل التدفق باستخدام مقاييس مختلفة ، بما في ذلك لتر / دقيقة (LPM) و / أو سنتيمترات مكعبة في الدقيقة (سم 3 / دقيقة أو سم مكعب / دقيقة). على سبيل المثال ، يمكن توصيل NO إلى موضوع بمعدل تدفق يتراوح من حوالي 0.1 لتر / دقيقة إلى حوالي 2.0 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.9 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.8 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.7 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.6 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.5 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة حوالي 1.4 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.3 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.2 لتر / دقيقة ، من حوالي 0.1 إلى حوالي 1.1 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 1.0 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.9 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.8 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.7 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.6 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.5 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.1 لتر / دقيقة حوالي 0.4 لتر / دقيقة ، من حوالي 0.1 لتر / دقيقة إلى حوالي 0.3 لتر / دقيقة ، ومن حوالي 0.1 لتر / دقيقة إلى حوالي 0.2 لتر / دقيقة. في بعض الجوانب ، يمكن توصيل NO إلى موضوع بمعدل تدفق يبلغ حوالي 0.1 لتر / دقيقة ، حوالي 0.2 لتر / دقيقة ، حوالي 0.3 لتر / دقيقة ، حوالي 0.4 لتر / دقيقة ، حوالي 0.5 لتر / دقيقة ، حوالي 0.6 لتر / دقيقة ، حوالي 0.7 لتر / دقيقة ، حوالي 0.8 لتر / دقيقة ، وحوالي 0.9 لتر / دقيقة ، حوالي 1.0 لتر / دقيقة ، حوالي 1.2 لتر / دقيقة ، حوالي 1.3 لتر / دقيقة ، حوالي 1.4 لتر / دقيقة ، حوالي 1.5 لتر / دقيقة دقيقة ، حوالي 1.6 لتر / دقيقة ، حوالي 1.7 لتر / دقيقة ، حوالي 1.8 لتر / دقيقة ، حوالي 1.9 لتر / دقيقة ، وحوالي 2.0 لتر / دقيقة ، أو ما يعادلها.

في بعض النماذج ، يمكن استخدام أنظمة توصيل NO للكشف الحالي لإدارة NO إلى موقع جرح الشخص لفترة زمنية معينة. على سبيل المثال ، يمكن توصيل NO إلى موضوع لفترة زمنية تتراوح من حوالي 30 دقيقة إلى حوالي 180 دقيقة ، من حوالي 30 دقيقة إلى حوالي 170 دقيقة ، من حوالي 30 دقيقة إلى حوالي 160 دقيقة ، من حوالي 30 دقيقة إلى حوالي 150 دقيقة دقيقة ، من حوالي 30 دقيقة إلى حوالي 140 دقيقة ، من حوالي 30 دقيقة إلى حوالي 130 دقيقة ، من حوالي 30 دقيقة إلى حوالي 120 دقيقة ، من حوالي 30 دقيقة إلى حوالي 110 دقيقة ، من حوالي 30 دقيقة إلى حوالي 90 دقيقة ، من حوالي 30 دقيقة إلى حوالي 80 دقيقة ، من حوالي 30 دقيقة إلى حوالي 70 دقيقة ، من حوالي 30 دقيقة إلى حوالي 60 دقيقة ، من حوالي 30 دقيقة إلى حوالي 50 دقيقة ، ومن حوالي 30 دقيقة إلى حوالي 40 دقيقة. في بعض الجوانب ، يمكن توصيل NO إلى موضوع ما لفترة زمنية تبلغ حوالي 110 دقيقة ، حوالي 105 دقيقة ، حوالي 100 دقيقة ، حوالي 95 دقيقة ، حوالي 90 دقيقة ، حوالي 85 دقيقة ، حوالي 80 دقيقة ، حوالي 75 دقيقة ، حوالي 70 دقيقة ، حوالي 65 دقيقة ، حوالي 60 دقيقة ، حوالي 55 دقيقة ، حوالي 50 دقيقة ، حوالي 45 دقيقة ، حوالي 40 دقيقة ، حوالي 35 دقيقة ، حوالي 30 دقيقة ، حوالي 25 دقيقة ، حوالي 20 دقيقة ، حوالي 15 دقيقة ، حوالي 10 دقائق ، وحوالي 5 دقائق ، أو كما هو محدد ليكون مناسبًا للموضوع والجرح قيد الفحص.

في بعض النماذج ، يمكن أن تشتمل أجهزة وأنظمة توصيل NO للكشف الحالي على واحد أو أكثر من مستشعرات الغاز (على سبيل المثال ، أجهزة الاستشعار الكهروكيميائية) لقياس تركيز غاز واحد أو أكثر يتم تسليمه إلى الموضوع (الشكل 1 ، 135). على سبيل المثال ، يمكن أن تشتمل أنظمة توصيل الكشف الحالي على مستشعرات أكسيد النيتريك ، وأجهزة استشعار ثاني أكسيد النيتريك ، و / أو مستشعرات الأكسجين. يمكن أن تقترن هذه المستشعرات وظيفيًا بمصدر الغاز (على سبيل المثال ، خزان أو أسطوانة NO) و / أو يمكن أن تقترن بوحدة واجهة الموضوع لقياس تركيزات الغاز في موقع الجرح أو العدوى. في بعض الجوانب ، يمكن أن تساعد مستشعرات الغاز في الحفاظ على معدل تدفق ثابت وتركيز أكسيد النيتروجين خلال فترة معالجة معينة. في بعض الجوانب ، يمكن أن تشير المستشعرات إلى المستخدم (على سبيل المثال ، مقدم الرعاية الصحية) أن تركيز الغاز أعلى أو أقل من العتبة المحددة لبروتوكول علاج معين لموضوع ما ، وفي هذه الحالة يمكن للمستخدم ضبط واحد أو أكثر المعلمات ، مثل منظم ضغط الغاز أو منظم تدفق الغاز ، أو يمكن للمستخدم إيقاف المعالجة واستبدال مصدر الغاز بمصدر يحتوي على تركيزات مناسبة للغازات. في جوانب أخرى ، يمكن استخدام مستشعرات الغاز كجزء من بروتوكول لتطهير النظام ، بما في ذلك وحدة واجهة الموضوع ، من الأكسجين ، بحيث يمكن توصيل gNO إلى موضوع بطريقة خالية تمامًا من الأكسجين. على سبيل المثال ، يمكن توصيل تيار مستمر من gNO و / أو بلعة من gNO إلى موضوع من خلال وحدة واجهة الموضوع بينما يقيس مستشعر الأكسجين انخفاض تركيز الأكسجين في وحدة واجهة الموضوع. بمجرد أن يشير المستشعر إلى وجود القليل من الأكسجين أو عدم وجوده في النظام ، يمكن البدء في بروتوكول معالجة gNO.

بالإضافة إلى ذلك ، يمكن أن تشتمل أجهزة وأنظمة توصيل NO الخاصة بالكشف الحالي على آلية التنظيف. في بعض الجوانب ، يمكن استخدام آلية التنظيف لطرد أكسيد النيتروجين المستخدم أثناء العلاج وإعادة مستويات الأكسجين إلى وضعها الطبيعي حتى لا يتعرض الشخص لمستويات مرتفعة من أكسيد النيتروجين بعد إزالة وحدة واجهة الموضوع. يمكن أن تقترن آلية الشطف بمصدر غاز NO ، بحيث يمكن للمستخدم استبدال مصدر gNO المستخدم للمعالجة بمصدر غاز به تركيز أقل من NO وتركيز أعلى من الأكسجين (على سبيل المثال ، أسطوانة بها الهواء المحيط المضغوط أو الأكسجين النقي). في بعض الجوانب ، يمكن للمستخدم بعد ذلك تنشيط آلية التدفق لإزاحة gNO المدار سابقًا من وحدة واجهة الموضوع. يمكن تنفيذ آلية التنظيف وفقًا لبروتوكول محدد ، على سبيل المثال ، يمكن إدارة غاز التنظيف خلال فترة زمنية معينة بينما لا تزال وحدة واجهة الموضوع متصلة بالموضوع. في بعض الجوانب ، يمكن أن تتضمن آلية الشطف حقن بلعة من الهواء أو أكسجين منقى في جهاز التوصيل بعد فترة وجيزة من انتهاء معالجة gNO. في طريقة التشغيل هذه ، ليست هناك حاجة ماسة لبروتوكول التنظيف ، حيث سيتم حقن بلعة الهواء وتنتقل عبر جهاز التوصيل بسرعة. يمكن استخدام بروتوكولات التنظيف الأخرى وفقًا للمعايير والممارسات الطبية المقبولة ، كما يمكن التعرف عليها من قبل أحد المهارة العادية في الفن بناءً على الكشف الحالي.

يمكن استخدام نماذج أنظمة توصيل NO في الكشف الحالي للتخفيف من أعراض المرض أو الظروف الصحية وتحسين النتائج العلاجية في موضوع يتعلق بالجروح. على سبيل المثال ، يمكن استخدام أنظمة توصيل NO في الكشف الحالي لعلاج الأشخاص الذين يعانون من حالات صحية ، على سبيل المثال ، داء السكري ، حيث من المعروف أن هؤلاء الأشخاص معرضون لخطر الإصابة بقرح جلدية حادة ومزمنة (على سبيل المثال ، قرح القدم ) ، في ظل وجود مضاعفات ثابتة طويلة الأمد للحالة الصحية أو المرض. يمكن أن تتراوح حدة العدوى الناتجة عن قرحة السكري من الداحس السطحي إلى الالتهابات العميقة التي تشمل العظام. من المتصور هنا أنه يمكن معالجة أي وجميع هذه الأنواع من القرحات باستخدام أنظمة وطرق الكشف الحالي. في نماذج معينة ، يمكن أن تشمل أنواع العدوى ، على سبيل المثال لا الحصر ، التهاب النسيج الخلوي والتهاب العضلات والخراجات والتهاب اللفافة الناخر والتهاب المفاصل الإنتاني والتهاب الأوتار والتهاب العظم والنقي.

بالإضافة إلى ذلك ، يمكن استخدام تجسيدات أنظمة توصيل NO للكشف الحالي لعلاج عدوى الجلد والأنسجة الرخوة (SSTIs). تعد SSTIs شائعة ، ويمكن أن تكون SSTIs المعقدة (cSSTIs) هي الطرف الأكثر تطرفًا لهذا المؤشر. يمكن أن تشمل SSTIs مجموعة من العروض السريرية ، بما في ذلك على سبيل المثال لا الحصر ، العدوى العميقة الجذور ، والتي تتطلب عادةً التدخل الجراحي ، ووجود علامات جهازية للإنتان ، ووجود مضاعفات مراضة مشتركة ، مصاحبة قلة العدلات ، نقص التروية المصاحبة ، نخر الأنسجة والحروق والعض. المكورات العنقودية الذهبية هو السبب الأكثر شيوعًا لـ SSTI ، ومع ذلك ، فإن علم الأوبئة (على سبيل المثال ، السلالات المسببة) وقابلية المضادات الحيوية لا يمكن التنبؤ بها بدقة في الوقت الحالي. من المتصور أن الأنظمة والطرق التي تم الكشف عنها هنا يمكن استخدامها لتقليل مخاطر SSTIs وكذلك معالجتها.

يمكن أن توفر التجسيدات المختلفة لأنظمة توصيل NO التي تم الكشف عنها في التطبيق الحالي وسيلة لتقليل العدوى عن طريق تقليل الحمل الحيوي باستخدام gNO المضغوط الذي يتم تسليمه إلى موقع الجرح. على عكس العلاجات المتعلقة بالمضادات الحيوية ضد الكائنات المسببة للأمراض مثل البكتيريا ، فإن البكتيريا غير قادرة على تطوير مقاومة لـ GNO. لذلك ، لا تمثل أنظمة توصيل الكشف الحالي وسيلة فعالة عالميًا لعلاج و / أو منع العدوى عن طريق تقليل الحمل الحيوي في الجرح وتسريع الشفاء. يمكن استخدام نماذج التطبيق الحالي فيما يتعلق بأنظمة التوصيل NO لتقليل العدوى الموجودة بالفعل في أحد الأشخاص ، و / أو استخدامها بشكل وقائي لمنع تطور العدوى المسببة للأمراض ، على سبيل المثال ، عن طريق تطبيقها على موقع جرح جراحي أو شق جراحي. بالإضافة إلى ذلك ، يمكن استخدام GNO الذي يتم تسليمه باستخدام أنظمة وأجهزة الكشف الحالي لعلاج العدوى في مجموعة واسعة من الجروح وعلامات المرض في موضوع ما ، بما في ذلك ، على سبيل المثال لا الحصر ، مواقع العدوى المسببة للأمراض مثل الالتهابات البكتيرية والالتهابات الفطرية ، الالتهابات الفيروسية ، التهابات الأوالي ، الحروق ، الجروح ، التجاعيد ، الآفات ، وما شابه. يمكن أن تشمل الآفات ، على سبيل المثال لا الحصر ، الجرح الجراحي ، وصدمة الجرح ، والحرق ، والخراج ، والتقرن السفعي ، والجدرة ، والندبة ، وسرطان الجلد ومجموعة منها.

بالإضافة إلى ذلك ، تتضمن تجسيدات الكشف الحالي فيما يتعلق بأنظمة التوصيل NO استخدامات مع علاجات أخرى للتخفيف من أعراض المرض وتحسين النتائج العلاجية في موضوع يحتاج إلى مثل هذا العلاج. على سبيل المثال ، في حالة التهاب العظم والنقي ، لا يمكن الجمع بين الإعطاء وفقًا لنماذج الكشف الحالي مع طرق العلاج الأخرى المعروفة ، بما في ذلك على سبيل المثال لا الحصر ، إعطاء المضادات الحيوية ، والعلاج بالأكسجين عالي الضغط (HBO) ، وعلاج تنضير اليرقات ، ومستعمرة الخلايا الحبيبية - إدارة عامل التحفيز. في بعض الجوانب ، يمكن أن يكون للعلاج التوافقي تأثيرات تآزرية ويمكن أن يستبعد الحاجة إلى تدخل جراحي أكثر خطورة ، مثل البتر.

تم تضمين أمثلة على الكشف الحالي لتوضيح تجسيدات معينة مقدمة هنا. يجب أن يدرك أصحاب المهارة في المجال أن التقنيات التي تم الكشف عنها في الأمثلة التالية تمثل تقنيات تم اكتشافها لتعمل بشكل جيد في الممارسات التي تم الكشف عنها هنا. ومع ذلك ، يجب على أصحاب المهارة في الفن ، في ضوء الكشف الحالي ، أن يدركوا أنه يمكن إجراء العديد من التغييرات في تجسيدات معينة يتم الكشف عنها ولا تزال تحصل على نتيجة مماثلة أو مماثلة دون الخروج عن الروح والنطاق هنا.

تين. الشكل 4 هو رسم بياني يوضح تأثيرات NO المعالجة على الحِمل الحيوي باستخدام مقايسة العدوى ، بعد ثلاث ساعات من الإصابة ، وفقًا لتجسيد الكشف الحالي. عينات الجلد المصابة لمدة 3 ساعات مع المكورات العنقودية، MRSA ، Acinetobacter أو الزائفة وتعرض بعد ذلك لـ 1٪ gNO عند 1 ATM (14.695 رطل / بوصة مربعة) لمدة 90 دقيقة بمعدل تدفق 0.1 لتر / دقيقة. المكورات العنقودية الذهبية، نوع فرعي aureus Rosenbach (ATCC # 12600) المكورات العنقودية الذهبية، نوع فرعي aureus Rosenbach (ATCC # 33591) ، سلالة مقاومة للميثيسيلين من المكورات العنقودية الذهبية، نوع فج 92 راكدة بومانية (ATCC # BAA-747) و الزائفة الزنجارية (ATTC # BAA-47). السيطرة = الأنسجة المصابة غير المعالجة. تم إجراء ثلاث مجموعات من ثلاث نسخ لكل تجربة.

كما هو موضح في FIG. 4 ، العلاج الذي اشتمل على 1٪ gNO عند 1 ATM (14.695 رطل لكل بوصة مربعة) لمدة 90 دقيقة قلل بشكل كبير من الحِمل الحيوي في كل نوع من أنواع البكتيريا الأربعة التي تم اختبارها. بكتريا المكورة العنقودية البرتقالية تم تقليله بمقدار 5 أضعاف ، وتم القضاء على سلالات البكتيريا الأخرى بالكامل تقريبًا. توضح هذه النتائج فعالية إدارة NO لتقليل العدوى عن طريق تقليل الحِمل الحيوي في جرح الموضوع. بالإضافة إلى ذلك ، نظرًا لأنه تم إجراء هذه التجارب باستخدام نموذج عدوى حاد لمدة 3 ساعات ، فإن هذه البيانات تشير أيضًا إلى أنه لا يمكن استخدام أي علاج وفقًا للمعايير العلاجية المذكورة أعلاه للوقاية من العدوى وكذلك لعلاج العدوى.

انخفاض الحِمل الحيوي عند ضغوط أقل من 1.0 ATM

تم إجراء تجارب أيضًا لتحديد قدرة الحد من العدوى لإدارة gNO عند ضغوط مختلفة أقل من 1.0 ATM (14.695 رطل / بوصة مربعة) (بغض النظر عن الضغط المطبق بواسطة البيئة الخارجية بالإضافة إلى ذلك) باستخدام جهاز فرانز لزراعة الأنسجة الخلوية (أي ، 3-Ring) وجهاز توصيل NO محمول (أي جهاز الساق). تم توضيح نتائج مجموعة واحدة من التجارب أدناه في الجدول 1. تم إعطاء NO بتركيز 1 ٪ بعد 24 ساعة من الإصابة بالعدوى. بكتريا المكورة العنقودية البرتقالية. تفاوتت معدلات التدفق (سم 3 / دقيقة أو سم مكعب) من حوالي 100 إلى حوالي 1500 ، وتراوح تدفق التطهير (لتر / دقيقة أو LPM) من حوالي 0.1 إلى حوالي 1.5 ، ولم يتغير وقت التعرض بين حوالي 45 دقيقة إلى حوالي 105 دقيقة بين مجموعات وضوابط العلاج المختلفة. تم إجراء تعداد المستعمرات (log CFU) بتخفيفات مختلفة ، والتي يتم تمثيلها في الأعمدة الثمانية الأخيرة المسمى 0 ، 1 × 10 1 إلى 1 × 10 7 ("0" يشير إلى عدم التخفيف). توضح النتائج الواردة في الجدول 1 أن الحِمل الحيوي قد انخفض بشكل كبير (أي القتل الكلي) بعد إعطاء NO عند ضغوط منخفضة تصل إلى حوالي 0.15 ATM (2.2 رطل / بوصة مربعة) لأوقات التعرض التي تبلغ حوالي 105 دقيقة.

بالإضافة إلى ذلك ، تم إجراء فحوصات MTT لتقييم صلاحية الخلية بعد عدم تناولها. فحوصات MTT عبارة عن فحوصات قائمة على قياس الألوان تستخدم لتقييم صلاحية الخلية كدالة لتغير اللون. كما هو موضح أدناه في الجدول 2 ، تفاوتت صلاحية الخلية بعد إعطاء NO المضغوط عند حوالي 0.15 ATM (2.2 رطل / بوصة مربعة) لحوالي 105 دقيقة من حوالي 40٪ -50٪. لذلك ، فإن إعطاء NO عند ضغوط أقل من 1.0 ATM (14.695 رطل لكل بوصة مربعة) فعال لتقليل الحمل الحيوي ولا يضر بشكل كبير بقدرة الخلية.

تشير النتائج في الجدولين 2 و 3 إلى أنه يمكن توصيل أكسيد النيتروجين تحت ضغوط أقل من 1.0 ATM (14.695 رطل / بوصة مربعة) (بغض النظر عن الضغط الذي تمارسه البيئة الخارجية بالإضافة إلى الضغط الذي تمارسه) وتقليل العدوى بشكل فعال عن طريق تقليل العبء الحيوي دون المساس بشكل كبير بصحة خلايا الموضوع. استخدام الضغوط أقل من 1.0 ATM (14.695 رطل / بوصة مربعة) له فائدة إضافية تتمثل في طلب ضغط خارجي أقل على وحدة واجهة الموضوع للحفاظ على مانع التسرب ، مما يسهل إنشاء الختم وصيانته ، فضلاً عن توفير درجة أكبر من الراحة لـ الموضوع. إن تحقيق التوازن بين توصيل أكسيد النيتروجين عند ضغط مرتفع بدرجة كافية لتقليل الحِمل الحيوي مع الحفاظ على ختم فعال على الموضوع هو أحد المساهمات المهمة للكشف الحالي.

تين. 5A-5C عبارة عن أقسام نسيجية تمثيلية ملطخة للكشف عن وجود البكتيريا بكتريا المكورة العنقودية البرتقالية على أنسجة عينة الجلد المعالجة وغير المعالجة ، وفقًا لتجسيد الكشف الحالي. تين. تم أخذ 5A من الأنسجة التي أصيبت لكنها تركت سليمة. تين. تم أخذ 5B من الأنسجة المصابة والمصابة لمدة 3 ساعات بكتريا المكورة العنقودية البرتقالية. تين. تم أخذ 5C من الأنسجة المصابة والمصابة لمدة 24 ساعة بكتريا المكورة العنقودية البرتقالية. المقاطع النسيجية التمثيلية ملطخة بـ Giesma ، الذي يحدد بكتريا المكورة العنقودية البرتقالية البكتيريا الموجودة في أنسجة عينة الجلد. بكتريا المكورة العنقودية البرتقالية يمكن رؤية البكتيريا على سطح الجرح بعد 3 ساعات من الإصابة ، ولكن بعد 24 ساعة من الإصابة ، تغلغلت البكتيريا بشكل أكبر في الأنسجة.

كشف إنتاج بيوفيلم بواسطة بكتريا المكورة العنقودية البرتقالية في التهابات الجلد

يمكن أن تلعب الأغشية الحيوية دورًا في علم أمراض الأنسجة وهي هياكل معقدة تتكون من خلايا بكتيرية مدمجة في مصفوفة خارج الخلية تحتوي على السكريات والبروتينات والحمض النووي. يمكن أن تحد مصفوفة الأغشية الحيوية من فعالية العلاج بالمضادات الحيوية الموضعية في الجروح المصابة ويمكن أن تعيق التئام الجروح والاستجابات المناعية. يمكن تصور المكونات المختلفة للغشاء الحيوي والمصفوفة خارج الخلية باستخدام التقنيات النسيجية ، ويمكن أن توفر أساسًا لتقييم فعالية إدارة NO لتقليل الحِمل الحيوي للبكتيريا التي تشكل الأغشية الحيوية.

تين. 6A-6F عبارة عن أقسام نسيجية تمثيلية ملطخة للكشف عن مكونات الغشاء الحيوي البكتيري ، وفقًا لتجسيد الكشف الحالي. عينات الجلد المستخدمة في التين. أصيب 6A-6F لمدة 24 ساعة بكتريا المكورة العنقودية البرتقالية البكتيريا ، ثم يتم تثبيتها في الفورمالين ، والمدمجة ، والمقطعة إلى شرائح بزيادات 5-6 ميكرومتر. تين. تم أخذ 6A من الأنسجة الملطخة بهيماتوكسيلين ويوزين. تين. تم أخذ 6B من الأنسجة الملطخة بتفاعل Feulgen. تين. تم أخذ 6C من الأنسجة الملطخة بأحمر الكونغو المعدلة. تين. تم أخذ 6D من الأنسجة الملطخة بأحمر الكونغو المعدل مع Carbol Fuchsin. تين. تم أخذ 6E من الأنسجة الملطخة بـ PAS. تين. 6F ملطخ بـ Calcofluor. باستخدام هذه التقنيات النسيجية ، يمكن أخذ عينة من أنسجة الجلد قبل وبعد العلاج بأكسيد النيتروجين المضغوط لتحديد التخفيضات في الحِمل الحيوي للبكتيريا التي تشكل الأغشية الحيوية.

يشتمل الكشف الحالي ، في جوانب وتجسيدات وتكوينات مختلفة ، على المكونات والطرق والعمليات والأنظمة و / أو الأجهزة إلى حد كبير كما هو موضح ووصف هنا ، بما في ذلك الجوانب المختلفة ، والتجسيدات ، والتكوينات ، والتركيبات الفرعية ، والمجموعات الفرعية منها. سوف يفهم أصحاب المهارة في الفن كيفية صنع واستخدام الجوانب والجوانب والتجسيدات والتكوينات المختلفة ، بعد فهم الكشف الحالي. يتضمن الكشف الحالي ، في جوانب وتجسيدات وتكوينات مختلفة ، توفير الأجهزة والعمليات في حالة عدم وجود عناصر غير موصوفة و / أو موصوفة هنا أو في جوانب وتجسيدات وتكوينات مختلفة هنا ، بما في ذلك في حالة عدم وجود عناصر قد تم استخدامها في الأجهزة أو العمليات السابقة ، على سبيل المثال ، لتحسين الأداء وتحقيق السهولة و أو تقليل تكلفة التنفيذ.

تم تقديم المناقشة السابقة حول الإفصاح لأغراض التوضيح والوصف. ما سبق لا يقصد به حصر الإفصاح عن النموذج أو النماذج التي تم الكشف عنها هنا. في الوصف التفصيلي السابق على سبيل المثال ، تم تجميع الميزات المختلفة للكشف معًا في واحد أو أكثر من الجوانب والتجسيدات والتكوينات بغرض تبسيط الإفصاح. يمكن دمج ميزات جوانب الكشف وتجسيداته وتشكيلاته في جوانب وتجسيدات وتشكيلات بديلة بخلاف تلك التي تمت مناقشتها أعلاه. لا يجب تفسير طريقة الإفصاح هذه على أنها تعكس نية أن الإفصاح المطالب به يتطلب ميزات أكثر مما هو مذكور صراحة في كل مطالبة. بدلاً من ذلك ، كما تعكس المطالبات التالية ، تكمن الجوانب الابتكارية في أقل من جميع ميزات الجوانب الفردية والتجسيدات والتكوينات التي تم الكشف عنها سابقًا. وبالتالي ، يتم دمج المطالبات التالية بموجب هذا الوصف التفصيلي ، مع كل مطالبة قائمة بذاتها كتجسيد مفضل منفصل للإفصاح.

علاوة على ذلك ، على الرغم من أن وصف الإفصاح قد تضمن وصفًا لواحد أو أكثر من الجوانب أو التجسيدات أو التكوينات وبعض الاختلافات والتعديلات ، فإن الاختلافات والتوليفات والتعديلات الأخرى تقع ضمن نطاق الكشف ، على سبيل المثال ، كما قد يكون ضمن المهارة ومعرفة من هم في المجال ، بعد فهم الكشف الحالي. الغرض منه هو الحصول على الحقوق التي تتضمن جوانب وتجسيدات وتكوينات بديلة إلى الحد المسموح به ، بما في ذلك الهياكل أو الوظائف أو النطاقات أو الخطوات البديلة والقابلة للتبادل و / أو المكافئة لتلك المطالب بها ، سواء كانت بديلة أو قابلة للتبديل و / أو مكافئة أم لا يتم الكشف عن الهياكل أو الوظائف أو النطاقات أو الخطوات هنا ، وبدون نية تكريس أي موضوع محمي ببراءة.


المطالبات

1. طريقة علاج مرض السرطان تشمل:

إعطاء جرعة علاجية فعالة من اللقاح داخل الورم إلى شخص يحتاج إليها.

2. طريقة المطالبة 1 ، حيث يكون اللقاح أحادي التكافؤ أو متعدد التكافؤ.

3. الطريقة حسب الادعاء 1 ، حيث يكون اللقاح هو لقاح الأنفلونزا.

4. الطريقة حسب الادعاء 3 ، حيث يكون لقاح الأنفلونزا هو لقاح الأنفلونزا الموسمية.

5. الطريقة وفقًا لعنصر الحماية 1 ، حيث يتم اختيار اللقاح من المجموعة المكونة من DTaP (الدفتيريا والسعال الديكي والتيتانوس) ، الالتهاب الرئوي (الالتهاب الرئوي بالمكورات الرئوية) ، التهاب الكبد B (التهاب الكبد B) ، MMR (الحصبة والنكاف والحصبة الألمانية).

6. الطريقة حسب الادعاء 1 ، حيث يكون لقاح الأنفلونزا هو لقاح معتمد من إدارة الغذاء والدواء.

7. الطريقة وفقًا لعنصر الحماية 1 ، حيث يتم إعطاء جرعات متعددة من اللقاح.

8. الطريقة وفقًا لعنصر الحماية 1 ، حيث يتم الإعطاء داخل الورم عن طريق الحقن أو أثناء إجراء الخزعة.

9. الطريقة وفقًا لعنصر الحماية 1 ، حيث يتم تعطيل اللقاح.

10. الطريقة وفقًا لعنصر الحماية 1 ، حيث يكون اللقاح غير محاليل.

11. الطريقة وفقًا للمطالبة 1 ، حيث يتم اختيار السرطان من المجموعة التي تتكون من الورم الميلاني ، والرئة ذات الخلايا غير الصغيرة ، والرئة ذات الخلايا الصغيرة ، والرئة ، وسرطان الكبد ، والورم الأرومي الشبكي ، والورم النجمي ، والورم الأرومي الدبقي ، وسرطان الدم ، والورم الأرومي العصبي ، والرأس ، والعنق ، الثدي ، البنكرياس ، البروستاتا ، الكلى ، العظام ، الخصية ، المبيض ، ورم الظهارة المتوسطة ، عنق الرحم ، الجهاز الهضمي ، الجهاز البولي التناسلي ، الجهاز التنفسي ، المكونة للدم ، الجهاز العضلي الهيكلي ، الغدد الصماء العصبية ، السرطان ، الساركوما ، الجهاز العصبي المركزي ، الجهاز العصبي المحيطي ، سرطان الغدد الليمفاوية ، الدماغ ، القولون سرطان.

12.الطريقة وفقًا لعنصر الحماية 1 ، تشتمل أيضًا على إعطاء علاج إضافي واحد على الأقل مضاد للسرطان.

13. الطريقة المنصوص عليها في المطالبة 12 ، حيث يكون العلاج الإضافي المضاد للسرطان هو العلاج الجراحي ، العلاج الكيميائي ، العلاج الإشعاعي ، العلاج الهرموني ، العلاج المناعي ، العلاج الجزيئي الصغير ، العلاج بمثبطات مستقبلات كيناز ، العلاج المضاد لتولد الأوعية ، العلاج الخلوي ، العلاج بالتبريد ، الاستئصال الإشعاعي أو العلاج البيولوجي.

14. الطريقة وفقاً لعنصر الحماية 12 ، حيث يكون علاج إضافي واحد على الأقل مضاد للسرطان هو مثبط لنقطة التفتيش المناعي.

15. الطريقة وفقاً لعنصر الحماية 14 ، حيث يتم اختيار مثبط نقطة تفتيش واحدة على الأقل من مثبط موت الخلايا التائية المبرمج 1 (PD-1) ، رابط موت الخلايا التائية المبرمج 1 (PD-L1) ، PDL-2 ، السام للخلايا T - مستضد الخلايا اللمفاوية 4 (CTLA-4) ، جين تنشيط الخلايا الليمفاوية 3 (LAG-3) ، تيم -3 ، CD28 ، CD122 ، أو CD137.

16. الطريقة وفقاً لعنصر الحماية 15 ، حيث يكون مثبط نقطة تفتيش واحد على الأقل هو جسم مضاد لـ PD-1 ، أو جسم مضاد لـ PD-L1 ، أو جسم مضاد لـ PD-L2 ، أو جسم مضاد لـ CTLA4 ، أو جسم مضاد لـ LAG3.

17. الطريقة وفقاً لعنصر الحماية 16 ، حيث يتم اختيار الجسم المضاد لـ PD-1 من المجموعة المكونة من nivolumab و pembrolizumab و pidilizumab و AMP-514 و REGN2810 و CT-011 و BMS 936559 و MPDL3280A و AMP-224 ، حيث يتم اختيار الجسم المضاد لـ PD-L1 من المجموعة التي تتكون من durvalumab و atezolizumab و avelumab وحيث يكون الجسم المضاد لـ CTLA-4 هو tremelimumab أو ipilimumab.

18. الطريقة وفقًا لعنصر الحماية 14 ، حيث يتم إعطاء أكثر من مثبط لنقاط التفتيش.

19. طريقة لزيادة الاستجابة المناعية في الورم ، وتتكون الطريقة من:

إعطاء جرعة علاجية فعالة من لقاح الأنفلونزا داخل الورم إلى شخص يحتاج إليها.

20. طريقة الادعاء رقم 19 ، حيث يكون لقاح الأنفلونزا هو لقاح غير محفز للخلايا البائية.


مراجع

Matteucci، M.D & amp Caruthers، M.H. توليف deoxyoligonucleotides على دعامة بوليمر. جيه. تشيم. شركة 103, 3185–3191 (1981).

سايكي ، ر.ك.وآخرون. التضخيم الأنزيمي الموجه من قبل التمهيدي للحمض النووي باستخدام بوليميراز DNA القابل للحرارة. علم 239, 487–491 (1988).

هوتشيسون ، سي أ وآخرون. الطفرات في موضع معين في تسلسل الحمض النووي. J. بيول. تشيم. 253, 6551–6560 (1978).

Heim، R. & amp Tsien، R. Y. هندسة البروتين الفلوري الأخضر لتحسين السطوع وأطوال موجية أطول ونقل طاقة الرنين الفلوري. بالعملة. بيول. 6, 178–182 (1996).

Barbas، C.F، Kang، A. S.، Lerner، R.A & amp Benkovic، S.J. تجميع مكتبات الأجسام المضادة التوافقية على أسطح الملتهمة: موقع الجين الثالث. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 88, 7978–7982 (1991).

Wang، L.، Brock، A.، Herberich، B. & amp Schultz، P. G. توسيع الشفرة الوراثية للإشريكية القولونية. علم 292, 498–500 (2001).

ليرنر ، R. A. ، Benkovic ، S. J. & amp Schultz ، P.G. عند مفترق طرق الكيمياء والمناعة: الأجسام المضادة التحفيزية. علم 252, 659–667 (1991).

سيجل ، ج.ب.وآخرون. التصميم الحسابي لمحفز إنزيم لتفاعل انتقائي ثنائي الجزيء Diels-Alder. علم 329, 309–313 (2010).

وانج ، ل. وآخرون. علم الجينوم التركيبي: من تخليق الحمض النووي إلى تصميم الجينوم. انجيو. تشيم. كثافة العمليات إد. 57, 1748–1756 (2018).

جيبسون ، دي جي وآخرون. تكوين خلية بكتيرية يتحكم فيها جينوم مركب كيميائيًا. علم 329, 52–56 (2010).

Annaluru، N. et al. التوليف الكلي لكروموسوم حقيقي النواة مصمم وظيفي. علم 344, 55–58 (2014).

Naldini، L. يعود العلاج الجيني إلى مركز الصدارة. طبيعة سجية 526, 351–360 (2015).

دنبار ، سي إي وآخرون. العلاج الجيني يأتي في سن الرشد. علم 359، eaan4672 (2018).

شيريدان ، سي. العلاج الجيني يجد مكانته. نات. التكنولوجيا الحيوية. 29, 121–128 (2011).

Jenks ، S. الموت العلاج الجيني - "على الجميع المشاركة في الذنب". J. Natl Cancer Inst. 92, 98–100 (2000).

Wang، T.، Upponi، J.R & amp Torchilin، V. P. تصميم نواقل جينية غير فيروسية متعددة الوظائف للتغلب على الحواجز الفسيولوجية: المعضلات والاستراتيجيات. كثافة العمليات J. فارم. 427, 3–20 (2012).

جوليانو ، ر. ل. تسليم أليغنوكليوتيدات علاجية. الدقة الأحماض النووية. 44, 6518–6548 (2016).

يين ، هـ وآخرون. نواقل غير فيروسية للعلاج الجيني. نات. القس جينيه. 15, 541–555 (2014).

Hill، A.B، Chen، M.، Chen، C.K، Pfeifer، B. A. & amp Jones، C.H. التغلب على عقبات توصيل الجينات: الاعتبارات الفسيولوجية للنواقل غير الفيروسية. اتجاهات التكنولوجيا الحيوية. 34, 91–105 (2016).

Giacca، M. & amp Zacchigna، S. تسليم الجينات بوساطة الفيروس للعلاج الجيني البشري. J. التحكم. يطلق 161, 377–388 (2012).

Merten، O. W. & amp Gaillet، B. النواقل الفيروسية للعلاج الجيني ومقاربات تعديل الجينات. بيوتشيم. م. ج. 108, 98–115 (2016).

Melchiorri، D. et al. التقييم التنظيمي لـ Glybera في أوروبا - لجنتان ، مهمة واحدة. نات. القس اكتشاف المخدرات. 12, 719 (2013).

Peng، Z. الوضع الحالي للجنديسين في الصين: عامل Ad-p53 البشري المؤتلف لعلاج السرطانات. همم. الجين هناك. 16, 1016–1027 (2005).

راسل ، إس وآخرون. فعالية وسلامة voretigene neparvovec (AAV2-hRPE65v2) في المرضى الذين يعانون من ضمور الشبكية الوراثي بوساطة RPE65: تجربة عشوائية ، خاضعة للرقابة ، مفتوحة التسمية ، المرحلة 3. لانسيت 390, 849–860 (2017).

كايزر ، ج. فرصة ثانية. علم 358, 582–585 (2017).

سنيور ، إم. بعد انسحاب غليبيرا ، ما الخطوة التالية للعلاج الجيني؟ نات. التكنولوجيا الحيوية. 35, 491–492 (2017).

Hajj، K. A. & amp Whitehead، K. A. أدوات للترجمة: مواد غير فيروسية لتوصيل الرنا المرسال العلاجي. نات. القس ماطر. 2, 17056 (2017).

Kaczmarek ، J.C ، Kowalski ، P. S. & amp Anderson ، D.G. تقدم في تقديم علاجات الحمض النووي الريبي: من المفهوم إلى الواقع السريري. جينوم ميد. 9, 60 (2017).

Reichmuth، A. M.، Oberli، M. A.، Jaklenec، A.، Langer، R. & amp Blankschtein، D. mRNA تسليم لقاح باستخدام الجسيمات النانوية الدهنية. هناك. ديليف. 7, 319–334 (2016).

ستانتون ، إم جي الوضع الحالي لأنظمة توصيل الرنا الرسول. حمض نووي. هناك. 28, 158–165 (2018).

Hartung، T. & amp Daston، G. هل الاختبارات المعملية مناسبة للاستخدام التنظيمي؟ توكسيكول. علوم. 111, 233–237 (2009).

Khvorova، A. & amp Watts، J.K. التطور الكيميائي للعلاجات قليلة النوكليوتيد ذات المنفعة السريرية. نات. التكنولوجيا الحيوية. 35, 238–248 (2017). تقدم هذه المراجعة نظرة عامة شاملة على التعديلات الكيميائية لأوليغنوكليوتيدات ذات الأهمية الطبية.

كومار ، إس آر ، ماركوسيك ، دي إم ، بيسواس ، إم ، هاي ، كي إيه ، أمبير هيرزوغ ، آر دبليو التطوير السريري للعلاج الجيني: النتائج والدروس المستفادة من النجاحات الأخيرة. مول. هناك. طرق كلين. ديف. 3, 16034 (2016).

Ginn، S.L، Amaya، A. K.، Alexander، I. E.، Edelstein، M. & amp Abedi، M.R. J. جين ميد. 20، e3015 (2018).

Stein، C.A & amp Castanotto، D. علاجات قليل النوكليوتيد المعتمدة من إدارة الغذاء والدواء الأمريكية في عام 2017. مول. هناك. 25, 1069–1075 (2017).

Zuckerman، J. E. & amp Davis، M. E. الخبرات السريرية مع العلاجات القائمة على سيرنا المدارة بشكل منهجي في السرطان. نات. القس اكتشاف المخدرات. 14, 843–856 (2015).

Barata، P.، Sood، A.K & amp Hong، D.S RNA-Targeted Therapeutics in cancer Clinical Studies: الوضع الحالي والاتجاهات المستقبلية. علاج السرطان. القس. 50, 35–47 (2016).

آدامز ، د. وآخرون. باتيسيران ، علاج RNAi ، لداء النشواني ترانستيريتين الوراثي. إنجل. جيه ميد. 379, 11–21 (2018).

شتاين ، سي أ وآخرون. إسكات الجين الفعال عن طريق توصيل قليل النوكليوتيدات المضاد للحمض النووي المغلق ، بدون مساعدة بواسطة كواشف تعداء. الدقة الأحماض النووية. 38، e3 (2010).

جوينفال ، إيه وآخرون. التصحيح الوظيفي في نماذج الفئران للحثل العضلي باستخدام أوليغومرات الحمض النووي ثلاثية الحلقات exon. نات. ميد. 21, 270–275 (2015).

Geary، R. S.، Baker، B. F. & amp Crooke، S. T. كلين. حركية الدواء. 54, 133–146 (2015).

Souleimanian، N. et al. Antisense 2ʹ-deoxy، 2ʹ-fluoroarabino nucleic acid (2’F-ANA) oligonucleotides: كاتمات الصوت في المختبر للتعبير الجيني التي يتم تعزيز فعاليتها بواسطة الأحماض الدهنية. مول. هناك. احماض نووية 1، e43 (2012).

Azad، R. F.، Brown-Driver، V.، Buckheit، R. W. & amp Anderson، K.P. Res المضادة للفيروسات. 28, 101–111 (1995).

Chi ، X. ، Gatti ، P. & amp Papoian ، T. اكتشاف المخدرات. اليوم 22, 823–833 (2017).

شين ، دبليو وآخرون. ترتبط السمية الكبدية الحادة لأوليغنوكليوتيدات الفوسفوروثيوات المعدلة بمقدار 2ʹ فلورو المعدل 5-10-5 في الفئران بربط البروتين داخل الخلايا وفقدان بروتينات DBHS. الدقة الأحماض النووية. 46, 2204–2217 (2018).

بورديك ، إيه دي وآخرون. الأشكال المتسلسلة المرتبطة بالسمية الكبدية لأوليغنوكليوتيدات حمض نووي مقفل معدلة ومضادة للحساسية. الدقة الأحماض النووية. 42, 4882–4891 (2014).

Fuertes، A.، Juanes، M.، Granja، J. R. & amp Montenegro، J. تشيم. كومون. 53, 7861–7871 (2017).

ميد ، بي آر وآخرون. التسليم الفعال للعقاقير الأولية RNAi التي تحتوي على تعديلات العمود الفقري phosphotriester القابلة للانعكاس لتحييد الشحنة. نات. التكنولوجيا الحيوية. 32, 1256–1261 (2014). تقدم هذه الدراسة طريقة للإنتاج الفعال لمشتقات الحمض النووي الفوسفوتريستر التي تتمتع بخصائص استهداف وتسليم ممتازة.

مكنمارا ، ج.أو وآخرون. تسليم نوع خلية محدد من siRNAs باستخدام خيمرات aptamer-siRNA. نات. التكنولوجيا الحيوية. 24, 1005–1015 (2006).

شو ، د. وآخرون. التسليم الجهازي لمضاد ميرنا لقمع سرطان الثدي الثلاثي السلبي باستخدام تقنية النانو RNA. ACS نانو 9, 9731–9740 (2015).

رن ، ك وآخرون. إستراتيجية القفل والمفتاح المزدوجة للحمض النووي لتسليم سيرنا الخاص بنوع الخلية الفرعي. نات. كومون. 7, 13580 (2016).

شميت ، ك وآخرون. توصيف تأثير العمود الفقري GalNAc و phosphorothioate على ارتباط oligonucleotides المضادة للحساسية بمستقبلات البروتين اللاسيوجلي. الدقة الأحماض النووية. 45, 2294–2306 (2017).

تانويتز ، إم وآخرون. يتوسط مستقبل البروتين الأسيوغليكوبروتين 1 الامتصاص الإنتاجي لـ N-acetylgalactosamine المترافق وغير المقترن قليل النوكليوتيدات الفوسفوروثيوات المضادة إلى خلايا الكبد الكبدية. الدقة الأحماض النووية. 45, 12388–12400 (2017).

زلاتيف ، آي وآخرون. عكس إسكات الجينات بوساطة سيرنا في الجسم الحي نات. التكنولوجيا الحيوية. 36, 509–511 (2018).

هوانغ ، واي.التطورات السريرية قبل السريرية في علاجات الحمض النووي المزينة بـ GalNAc. مول. هناك. احماض نووية 6, 116–132 (2017).

لو ، إكس وآخرون. تنظيم فعال للجينات المضادة للحساسية من خلال فرش البولي إيثيلين جلايكول غير الموجبة. جيه. تشيم. شركة 138, 9097–9100 (2016).

جيا ، إف وآخرون. تحديد العمق لاستقرار نوكلياز وفعالية إسكات الجينات لمقارنات بولي (إيثيلين جلايكول) - دنا. جيه. تشيم. شركة 139, 10605–10608 (2017).

جين ، واي وآخرون. زهور نانوية متناهية الصغر قابلة للتحلل ، ومتعددة الوظائف لتحسين علاج السرطان. NPG آسيا ماتر. 9، e365 (2017).

لي ، جيه إتش وآخرون. الجسيمات النانوية سيرنا البوليمرية المستندة إلى النسخ المتداول الدائرة للتسليم الموجه للورم. J. التحكم. يطلق 263, 29–38 (2017).

روزيما ، دي.بي وآخرون. مركبات توصيل سيرنا المشغلة بالبروتياز. J. التحكم. يطلق 209, 57–66 (2015).

لي ، ك وآخرون. التسليم في الجسم الحي لعوامل النسخ مع قليل النوكليوتيدات متعددة الوظائف. نات. ماتر. 14, 701–706 (2015). تقدم هذه الورقة إجراءً لإيصال عوامل النسخ في الجسم الحي باستخدام أليغنوكليوتيدات التي تم تعديلها باستخدام التركيبات المستجيبة للأس الهيدروجيني..

McCaffrey، J.، Donnelly، R.F & amp McCarthy، H.O. Microneedles: منصة مبتكرة لتوصيل الجينات. المخدرات Deliv. ترجمة الدقة. 5, 424–437 (2015).

Suda، T. & amp Liu، D. تسليم الجينات الهيدروديناميكية: مبادئها وتطبيقاتها. مول. هناك. 15, 2063–2069 (2007).

ستيوارت ، إم ب وآخرون. استراتيجيات في المختبر وخارج الجسم الحي للتسليم داخل الخلايا. طبيعة سجية 538, 183–192 (2016).

جاكسون ، إتش جيه ، رفيق ، إس ، وأمبيرنتجينز ، آر. نات. القس كلين. اونكول. 13, 370–383 (2016).

دينغ إكس وآخرون. توصيل نووي عالي الإنتاجية والتعبير السريع للحمض النووي عن طريق تعطيل غشاء الخلية الميكانيكي والكهربائي. نات. بيوميد. م. 1, 0039 (2017).

شيابيني ، سي وآخرون. إبر السليكون النانوية القابلة للتحلل الحيوي التي توفر الأحماض النووية داخل الخلايا تحفز الأوعية الدموية المحلية في الجسم الحي. نات. ماتر. 14, 532–539 (2015).

Anderson، C.D، Moisyadi، S.، Avelar، A.، Walton، C.B & amp Shohet، R. V. الجين هناك. 23, 510–519 (2016).

مانتا ، إس وآخرون. الفقاعات الدقيقة الموجبة و miniplasmid الخالية من المضادات الحيوية من أجل التعبير المستمر عن الجينات المحورة عبر الموجات فوق الصوتية في الكبد. J. التحكم. يطلق 262, 170–181 (2017).

Chertok ، B. ، Langer ، R. S. & amp Anderson ، D.G. التحكم المكاني للتعبير الجيني بواسطة ناقلات النانو باستخدام إخفاء الهيبارين وتدمير الفقاعات الدقيقة المستهدفة بالموجات فوق الصوتية. ACS نانو 10, 7267–7278 (2016).

Yoon، S.، Wang، P.، Peng، Q.، Wang، Y. & amp Shung، K.K Acoustic-transfection للتلاعب الجيني للخلايا المفردة باستخدام الموجات فوق الصوتية عالية التردد. علوم. اعادة عد. 7, 5275 (2017).

باستوزين ، إي دي وآخرون. يقوم الجين العصبي Arc بتشفير بروتين Gag المعاد توظيفه والذي يتوسط نقل الحمض النووي الريبي بين الخلايا. زنزانة 172, 275 (2018).

Chen، L. S. et al. نقل الجينات الفعال باستخدام جسيم يشبه فيروس JC البشري الذي يمنع نمو سرطان القولون البشري في نموذج الفأر العاري. الجين هناك. 17, 1033–1041 (2010).

لي ، ب. دبليو وآخرون. هيكل البوليمر والتشكيل يغيران مولدات الضد لاتحادات الجسيمات-البوليمر الشبيهة بالفيروس. جيه. تشيم. شركة 139, 3312–3315 (2017).

Zackova Suchanova، J.، Neburkova، J.، Spanielova، H.، Forstova، J. & amp Cigler، P. إعادة توجيه الجزيئات الشبيهة بالفيروسات التورامية إلى الخلايا السرطانية عن طريق التعديل الكيميائي لسطح القفيصة. Bioconjug. تشيم. 28, 307–313 (2017).

تونغ ، جي جيه ، هسياو ، إس سي ، كاريكو ، زد إم آند فرانسيس ، إم. بي. قفيصة فيروسية تقارن أبتامير الحمض النووي كمركبات متعددة التكافؤ لاستهداف الخلايا. جيه. تشيم. شركة 131, 11174–11178 (2009).

إيجوتشي ، إيه وآخرون. توصيل siRNA الفعال إلى الخلايا الأولية عن طريق بروتين اندماج مجال ربط dsRNA لمجال تحويل الببتيد (PTD-DRBD). نات. التكنولوجيا الحيوية. 27, 567–571 (2009).

يانج ، إن جيه وآخرون. توصيل عصاري خلوي لـ siRNA بواسطة بروتينات ربط dsRNA عالية التقارب. الدقة الأحماض النووية. 45, 7602–7614 (2017).

Bienk، K. et al. استراتيجية قائمة على تصميم الكولسترول بوساطة الألبومين لضبط الحرائك الدوائية لـ siRNA وإسكات الجينات. J. التحكم. يطلق 232, 143–151 (2016).

ساريت ، إس إم وآخرون. تستهدف سيرنا المحبة للدهون الألبومين في الموقع وتعزز التوافر البيولوجي واختراق الورم وإسكات الجينات الخالية من الناقل. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 114، E6490 – E6497 (2017).

هفام ، إم إل وآخرون. بنيات قليلة النوكليوتيد وألبومين المصل المعدلة بالأحماض الدهنية لتعديل الحرائك الدوائية. مول. هناك. 25, 1710–1717 (2017).

سونج ، إي وآخرون. توسط الجسم المضاد في توصيل الجسم الحي لـ RNAs الصغيرة المتداخلة عبر مستقبلات سطح الخلية. نات. التكنولوجيا الحيوية. 23, 709–717 (2005).

كويلار ، ت.ل وآخرون. التقييم المنهجي لتوصيل siRNA بوساطة الجسم المضاد باستخدام منصة صناعية لاتحادات THIOMAB-siRNA. الدقة الأحماض النووية. 43, 1189–1203 (2015).

Lehto، T.، Ezzat، K.، Wood، M.J A. & amp El Andaloussi، S. Peptides for nucleic acid delivery. حال. المخدرات Deliv. القس. 106, 172–182 (2016).

Tai، W. & amp Gao، X. الببتيدات الوظيفية لتسليم سيرنا. حال. المخدرات Deliv. القس. 110–111, 157–168 (2017).

هاموند ، إس إم وآخرون. يحسن علاج قليل النوكليوتيد الجهازي بوساطة الببتيد البقاء على المدى الطويل في ضمور العضلات الشوكي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 113, 10962–10967 (2016).

Echigoya ، واي وآخرون. آثار تخطي multexon الجهازية مع المورفولينوس المترافق مع الببتيد في قلب نموذج كلب مصاب بالحثل العضلي الدوشيني. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 114, 4213–4218 (2017).

مدينا ، إس إتش وآخرون. يسهل الببتيد المضطرب جوهريًا دخول الخلايا غير داخل الجسم. انجيو. تشيم. كثافة العمليات إد. 55, 3369–3372 (2016).

Soudah، T.، Mogilevsky، M.، Karni، R. & amp Yavin، E. CLIP6-PNA-peptide اقترانات: توصيل غير داخلى للقليل النوكليوتيدات بتبديل لصق. Bioconjug. تشيم. 28, 3036–3042 (2017).

بولوت ، إس وآخرون. الإطلاق البطيء وتسليم عقار قليل النوكليوتيد المضاد للحساسية بواسطة ألياف نانوية متناهية الصغر من الببتيد الذاتي التجميع. الجزيئات الحيوية 12, 3007–3014 (2011).

Mazza، M.، Hadjidemetriou، M.، de Lázaro، I.، Bussy، C. & amp Kostarelos، K.Peptide nanofiber Complex with siRNA لإسكات جينات الدماغ العميقة عن طريق جراحة الأعصاب التجسيمية. ACS نانو 9, 1137–1149 (2015).

يولامانوفا ، إم وآخرون. تعزز الألياف النانوية الببتيدية نقل الجينات الفيروسية وتوفر وسيلة سريعة لتركيز الفيروسات. نات. النانو. 8, 130–136 (2013).

داي ، ب وآخرون. تجميع قابل للضبط من الببتيدات المكونة للأميلويد في صفائح نانوية كناقل للفيروسات القهقرية. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 112, 2996–3001 (2015).

مكارثي ، هـ. أوه وآخرون. تطوير وتوصيف الجسيمات النانوية ذاتية التجميع باستخدام ببتيد أمفيباثي مستوحى من الحيوية لتسليم الجينات. J. التحكم. يطلق 189, 141–149 (2014).

أوداياكومار ، ف.كيه وآخرون. المركبات النانوية المرنا المستندة إلى الببتيد الغنية بالأرجينين تحفز بكفاءة مناعة الخلايا التائية السامة للخلايا التي تعتمد على التنظيم الأمفيباثي للببتيد. حال. هيلث ج. ماتر. 6, 1601412 (2017).

دوات ، سي وآخرون. جهاز طوي مخترق للخلايا مع رابط قابل للانضغاط حيويًا لتوصيل الحمض النووي داخل الخلايا. انجيو. تشيم. كثافة العمليات إد. 54, 11133–11137 (2015).

جيهين ، سي وآخرون. مكتبات amphiphile ديناميكية لفحص التوصيل "العطري" لـ siRNA إلى خلايا هيلا والأرومات الليفية الأولية البشرية. جيه. تشيم. شركة 135, 9295–9298 (2013).

Louzao ، I. ، García-Fandiño ، R. & amp Montenegro ، J. Hydrazone-modulated peptides for gene transfection. جيه ماتر. تشيم. ب 5, 4426–4434 (2017).

Lostalé-Seijo، I.، Louzao، I.، Juanes، M. & amp Montenegro، J. Peptide / Cas9 nanostructures لنقل الغشاء الخلوي ribonucleoprotein وإصدار الجينات. تشيم. علوم. 8, 7923–7931 (2017).

لي ، م وآخرون. يؤدي دمج نظير أرجينين غير طبيعي في ببتيد دوري إلى تكوين ألياف نانوية موجبة الشحنة قادرة على نقل العدوى بالجينات. انجيو. تشيم. كثافة العمليات إد. 55, 598–601 (2016).

Li، M.، Schlesiger، S.، Knauer، S.K & amp Schmuck، C. يحول نموذج ربط الأنيون المحدد المصمم خصيصًا في السلسلة الجانبية رباعي الببتيد إلى ناقل فعال لتسليم الجينات. انجيو. تشيم. كثافة العمليات إد. 54, 2941–2944 (2015). يقدم هذا المقال مجموعة guanidiniocarbonyl pyrrole الجديدة لتسليم الحمض النووي.

مونتينيغرو ، ج. ، غديري ، إم آر ، وأمبير جرانجا ، جي آر أيون نماذج قنوات تعتمد على تجميع ذاتي للأنابيب النانوية الببتيدية الحلقية. Acc. تشيم. الدقة. 46, 2955–2965 (2013).

جانا ، ب. وآخرون. تعداء الجينات الفعالة من خلال تثبيط تكوين صفيحة (ألياف أميلويد) لببتيد قصير amphiphilic بواسطة جزيئات الذهب النانوية. انجيو. تشيم. كثافة العمليات إد. 56, 8083–8088 (2017).

فريري ، جي إم وآخرون. مجمعات الببتيدات التي تخترق خلايا siRNA كعلاج اندماجي ضد سرطان الدم النخاعي المزمن باستخدام خط خلية BV173 كنموذج. J. التحكم. يطلق 245, 127–136 (2017).

فيلجنر ، ب. ل. وآخرون. Lipofection: إجراء ترنسفكأيشن الحمض النووي عالي الكفاءة بوساطة الدهون. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 84, 7413–7417 (1987).

Allen، T. M. & amp Cullis، P.R. أنظمة توصيل الأدوية الليبوزومية: من المفهوم إلى التطبيقات السريرية. حال. المخدرات Deliv. القس. 65, 36–48 (2013).

Oude Blenke، E. E.، van den Dikkenberg، J.، van Kolck، B.، Kros، A. & amp Mastrobattista، E. coiled coil التفاعلات لاستهداف الجسيمات الشحمية لتسليم الحمض النووي. مقياس النانو 8, 8955–8965 (2016).

يانج ، جيه وآخرون. توصيل الدواء عن طريق اندماج غشاء الخلية باستخدام الجسيمات الشحمية المعدلة. ACS Cent. علوم. 2, 621–630 (2016).

O’Brien، P. J.، Elahipanah، S.، Rogozhnikov، D. & amp Yousaf، M.N. Bio-orthogonal transfection of nucleic acid transfection of الخلايا عبر هندسة سطح الخلية. ACS Cent. علوم. 3, 489–500 (2017). تصف هذه الدراسة طريقة لتطبيق الكيمياء الحيوية المتعامدة على اندماج الجسيمات الشحمية.

كوفمان ، ك.جيه وآخرون. تعظيم الاستفادة من تركيبات الجسيمات النانوية الدهنية لتسليم الرنا المرسال في الجسم الحي مع تصميمات الفرز الجزئي والنهائي. نانو ليت. 15, 7300–7306 (2015).

Farhood، H.، Serbina، N. & amp Huang، L. دور dioleoyl phosphatidylethanolamine في نقل الجينات الجسيمية الموجبة بوساطة. بيوكيم. بيوفيز. اكتا 1235, 289–295 (1995).

Leal، C.، Bouxsein، N.F، Ewert، K.K & amp Safinya، C.R. جيه. تشيم. شركة 132, 16841–16847 (2010).

Kim، H. & amp Leal، C. Cuboplexes: توصيل siRNA النشط طوبولوجيًا. ACS نانو 9, 10214–10226 (2015).

إيفرز ، إم جيه دبليو وآخرون.تصميم حديث وتقنيات إنتاج الخلط السريع للجسيمات النانوية الدهنية لتوصيل الحمض النووي. طرق صغيرة. https://doi.org/10.1002/smtd.201700375 (2018).

وايتهيد ، ك.أ وآخرون. الجسيمات النانوية الدهنية القابلة للتحلل مع نشاط توصيل siRNA يمكن التنبؤ به في الجسم الحي. نات. كومون. 5, 4277 (2014).

Viricel، W. et al. الدهون الكاتيونية القابلة للتحويل: التبديل الجزيئي المحفز بواسطة الأس الهيدروجيني لتسليم سيرنا. مقياس النانو 9, 31–36 (2017).

كرانز ، لام وآخرون. يستغل توصيل الحمض النووي الريبي الجهازي إلى الخلايا المتغصنة الدفاع المضاد للفيروسات في العلاج المناعي للسرطان. طبيعة سجية 534, 396–401 (2016).

أوبيرلي ، إم إيه وآخرون. ساعد الجسيمات النانوية الدهنية في توصيل الرنا المرسال للعلاج المناعي القوي للسرطان. نانو ليت. 17, 1326–1335 (2017).

ليانغ ، سي وآخرون. تستهدف الجسيمات النانوية الدهنية Aptamer الوظيفية بانيات العظم كإستراتيجية ابنائية جديدة تعتمد على تداخل الحمض النووي الريبي (RNA). نات. ميد. 21, 288–294 (2015).

ريبول ، إم وآخرون. تسمح مذيلات polydiacetylenic النانومترية المستجيبة للأس الهيدروجيني بتسليم siRNA بكفاءة داخل الخلايا. تطبيق ACS. ماتر. واجهات 8, 30665–30670 (2016).

Morin، E.، Nothisen، M.، Wagner، A. & amp Remy، J. S. Cationic polydiacetylene micelles لتوصيل الجينات. Bioconjug. تشيم. 22, 1916–1923 (2011).

Neuberg ، P. وآخرون. ألياف نانوية متعددة الأسيتيل كمركبات siRNA جديدة للتوصيل في المختبر وفي الجسم الحي. مقياس النانو 10, 1587–1590 (2018).

Jayaraman، M. et al. تعظيم فعالية الجسيمات النانوية الدهنية siRNA لإسكات الجينات الكبدية في الجسم الحي. انجيو. تشيم. كثافة العمليات إد. 51, 8529–8533 (2012).

يم ، ن وآخرون. هندسة Exosome للتوصيل الفعال للبروتينات القابلة للذوبان داخل الخلايا باستخدام وحدة تفاعل البروتين والبروتين القابل للانعكاس بصريًا. نات. كومون. 7, 12277 (2016).

لي ، ج وآخرون. الهندسة الخلوية مع الجسيمات الشحمية المغزلية الغشائية لإنتاج حويصلات وظيفية خارج الخلية. تطبيق ACS. ماتر. واجهات 8, 6790–6795 (2016). تصف هذه الدراسة طريقة متعددة الاستخدامات للتشغيل الكيميائي للإكسوسومات.

O’Loughlin، A. J. et al. التوصيل الوظيفي لـ siRNA المترافق بالدهون بواسطة حويصلات خارج الخلية. مول. هناك. 25, 1580–1587 (2017).

ديديوت ، إم سي وآخرون. تسليم بوساطة exosome من siRNA المعدلة مسعورًا لإسكات Huntingtin mRNA. مول. هناك. 24, 1836–1847 (2016).

كوي ، زد ك وآخرون. توصيل siRNA عبر الستيروسومات الموجبة لتعزيز التمايز العظمي للخلايا الجذعية الوسيطة. J. التحكم. يطلق 217, 42–52 (2015).

وانج واي وآخرون. استراتيجية تعتمد على الجسيمات النانوية لتصوير مجموعة واسعة من الأورام عن طريق التضخيم غير الخطي لإشارات البيئة المكروية. نات. ماتر. 13, 204–212 (2014).

شو ، إكس وآخرون. منصة نانوية فائقة الاستجابة للأس الهيدروجيني وتخترق الأورام لتوصيل siRNA المستهدف مع فعالية قوية لمكافحة السرطان. انجيو. تشيم. كثافة العمليات إد. 55, 7091–7094 (2016).

شو ، إكس وآخرون. منصة الجسيمات النانوية متعددة الوظائف من نوع siRNA لتسليم سرطان البروستاتا. ACS نانو 11, 2618–2627 (2017).

تشو ، ج. وآخرون. نانوميسيل حساسة لدرجة الحموضة لتوصيل siRNA عالي الكفاءة في المختبر وفي الجسم الحي: نظرة ثاقبة لتصميم polycations مع إطلاق عصاري خلوي قوي. نانو ليت. 16, 6916–6923 (2016). تركز هذه المقالة على خصائص polycations المطلوبة لتعظيم إطلاق العصارة الخلوية لشحنات siRNA في ظروف امتصاص منخفضة للغاية.

Chiper، M.، Tounsi، N.، Kole، R.، Kichler، A. & amp Zuber، G. ذاتية التجميع 1.8 كيلو دالتون بولي إيثيلينيمينز مع مفتاح حل في درجة الحموضة الحمضية الداخلية هي ناقلات توصيل لبلازميد DNA و mRNA و siRNA و exon- تخطي قليل النوكليوتيدات. J. التحكم. يطلق 246, 60–70 (2017).

Cheng، Y.، Yumul، R.C & amp Pun، S.H. بوليمر مستوحى من الفيروسات لتوصيل الجينات في المختبر وفي الجسم الحي بكفاءة. انجيو. تشيم. كثافة العمليات إد. 55, 12013–12017 (2016).

تشنغ ، واي وآخرون. تطوير بوليمرات قابلة للتحويل لمعالجة معضلة الاستقرار وتحرير الشحنات في حاملات الحمض النووي متعدد الكريات. المواد الحيوية 127, 89–96 (2017).

ماكينلاي ، سي جيه وآخرون. ناقلات تغيير الشحنات القابلة للإطلاق (CARTs) لتسليم وإطلاق mRNA في الحيوانات الحية. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 114، E448 – E456 (2017). تصف هذه الدراسة بوليمرًا متضخمًا ذاتيًا يمكنه توصيل الرنا المرسال في الخلايا الأولية وفي الجسم الحي.

شاهال ، ج.س وآخرون. تولد الجسيمات النانوية Dendrimer-RNA مناعة وقائية ضد الإيبولا القاتلة ، وأنفلونزا H1N1 ، و Toxoplasma gondii بجرعة واحدة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 113، E4133 – E4142 (2016).

ليو ، إس وآخرون. الزنك Bioreducible (ii) - البولي إيثيلينيمين المتناسق مع انخفاض الوزن الجزيئي لتوصيل الجينات القوية للخلايا الأولية والجذعية. جيه. تشيم. شركة 139, 5102–5109 (2017).

زو ، واي وآخرون. تعزز البوليمرات الكيميرية المحاكية للفيروسات علاج siRNA للسرطان المستهدف في الجسم الحي. حال. ماتر. 29, 1703285 (2017).

لي ، ل. وآخرون. يسلم الفيروس الاصطناعي نظام CRISPR-Cas9 لتحرير الجينوم للخلايا في الفئران. ACS نانو 11, 95–111 (2017).

نايتو ، إم وآخرون. مذيلة بوليون معقدة وظيفية من فينيلبورونات لإطلاق ATP من siRNA. انجيو. تشيم. كثافة العمليات إد. 51, 10751–10755 (2012).

نايتو ، إم وآخرون. التسليم المحسن داخل الخلايا لـ siRNA من خلال التحكم في استجابة ATP لمذيلات البوليون المعقدة التي تعمل بحمض فينيل بورونيك. ماكرومول. بيوسكي. 18, 1700357 (2018).

يوشيناغا ، ن. وآخرون. عززت micelles Polyplex مع الربط المتبادل للفينيلبورونات / الجلوكوناميد في اللب الذي يمارس ترنسفكأيشن الجينات من خلال الاستجابة الزمانية المكانية لدرجة الحموضة داخل الخلايا وتركيز ATP. جيه. تشيم. شركة 139, 18567–18575 (2017).

Truong، N. P. et al. نظام بوليمر مستوحى من فيروس الأنفلونزا للإفراج الموقوت عن سيرنا. نات. كومون. 4, 1902 (2013).

Wang، M.، Liu، H.، Li، L. & amp Cheng، Y. يحقق متغصن مفلور فعالية ممتازة في تعداء الجينات عند نسب منخفضة للغاية من النيتروجين إلى الفوسفور. نات. كومون. 5, 3053 (2014).

وانج هـ وآخرون. تجمع عوامل التعرق الفلورية المُجمَّعة ذاتيًا بين سمات النواقل الدهنية والبوليمرية في توصيل الجينات. انجيو. تشيم. كثافة العمليات إد. 54, 11647–11651 (2015).

Wang ، L.H ، Wu ، D. C. ، Xu ، H. X. & amp You ، Y. Z. تقارب عالي لربط الحمض النووي وفعالية نقل الجينات للنانوميسيل النانوية الكاتيونية الحيوية ذات النواة المفلورة. انجيو. تشيم. كثافة العمليات إد. 55, 755–759 (2016).

تشانغ ، زد وآخرون. تأثير الفلورة للفلورو أمفيفيل في توصيل البروتين الخلوي. نات. كومون. 9, 1377 (2018).

ديفيس ، إم إي.أول تسليم مستهدف لـ siRNA في البشر عبر جسيم نانوي: من المفهوم إلى العيادة. مول. فارم. 6, 659–668 (2009).

Maity، S.، Choudhary، P.، Manjunath، M.، Kulkarni، A. & amp Murthy، N. بوليمر أدامنتان قابل للتحلل الحيوي مع روابط كيتال في العمود الفقري للعلاج الجيني. تشيم. كومون. 51, 15956–15959 (2015).

Chen، X.، Qiu، Y. K.، Owh، C.، Loh، X. J. & amp Wu، Y. مقياس النانو 8, 18876–18881 (2016).

Eldredge، A.C، Johnson، M. E.، Oldenhuis، N.J & amp Guan، Z. الجزيئات الحيوية 17, 3138–3144 (2016).

يان ، واي وآخرون. تتيح البوليسترات الوظيفية توصيل siRNA انتقائي لسرطان الرئة على الخلايا الطبيعية المتطابقة. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 113، E5702 – E5710 (2016).

هاو ، ج. وآخرون. التوليف السريع لمكتبة البوليستر الدهنية عن طريق بلمرة فتح الحلقة من valerolactones الوظيفية لتوصيل siRNA الفعال. جيه. تشيم. شركة 137, 9206–9209 (2015).

بريج ، جيه إم وآخرون. البوليمرات الوظيفية في الموقع لتسليم سيرنا. انجيو. تشيم. كثافة العمليات إد. 55, 7492–7495 (2016).

بريج ، جيه إم وآخرون. البوليمرات المنشّطة بالهيدرازون بأطوال مختلفة لتكثيف DNA البلازميد وترنسفكأيشن الخلوي. الجزيئات الحيوية 19, 2638–2649 (2018).

تشاو ، واي وآخرون. يجمع PolyMetformin بين أنشطة الناقل والمضادة للسرطان لتسليم siRNA في الجسم الحي. نات. كومون. 7, 11822 (2016).

ليو ، واي وآخرون. بوليمر شبه موصّل متعرج كحامل نانوي ضوئي حراري للتنشيط عن بعد للتعبير الجيني. انجيو. تشيم. كثافة العمليات إد. 56, 9155–9159 (2017).

تان ، زد ، داندي ، واي ك ، وأمبير راينكي ، تي إم ، البوليمرات التي تخترق الخلايا والتي تحتوي على الجوانيدينيوم تؤدي إلى موت الخلايا المبرمج في خلايا سرطان الكبد البشري ما لم يتم اقترانها مع كتلة N-acetyl-galactosamine المستهدفة. Bioconjug. تشيم. 28, 2985–2997 (2017).

Liu، Y.، Wenning، L.، Lynch، M. & amp Reineke، T. M. New poly (D-glucaramidoamine) s تحفز تكوين جزيئات نانوية DNA وتسليم الجينات الفعال إلى خلايا الثدييات. جيه. تشيم. شركة 126, 7422–7423 (2004).

دونغ ، واي وآخرون. فرش بولي (غليكو أميدامين) مصنوعة من مواد نانوية لتوصيل siRNA و mRNA النظامي في الجسم الحي. نانو ليت. 16, 842–848 (2016).

كاكزماريك ، جيه سي وآخرون. جسيمات نانوية بوليمرية دهنية للتوصيل الجهازي للـ mRNA إلى الرئتين. انجيو. تشيم. كثافة العمليات إد. 55, 13808–13812 (2016).

لي ، ج. وآخرون. تجميع مبرمج هيكليًا من nanoplex لبدء الترجمة من أجل تسليم mRNA متفوق. ACS نانو 11, 2531–2544 (2017).

هونغ ، سي إيه وآخرون. سيرنا شجيري لإسكات الجينات بكفاءة. انجيو. تشيم. كثافة العمليات إد. 54, 6740–6744 (2015).

سميث ، تي تي وآخرون. البرمجة في الموقع للخلايا التائية الخاصة بسرطان الدم باستخدام ناقلات النانو الاصطناعية للحمض النووي. نات. النانو. 12, 813–820 (2017). تصف هذه الدراسة طريقة التعديل في الموقع للخلايا التائية للعلاج المناعي للسرطان.

Graham، F. L. & amp van der Eb، A. J.. أسلوب جديد لفحص قابلية الفيروس الغدي البشري 5 DNA. علم الفيروسات 52, 456–467 (1973).

Hong، G.، Diao، S.، Antaris، A.L & amp Dai، H. المواد النانوية الكربونية للتصوير البيولوجي والعلاج بالنانو. تشيم. القس. 115, 10816–10906 (2015).

بانتاروتو ، دي وآخرون. الأنابيب النانوية الكربونية الوظيفية لتوصيل الجينات البلازميدية. انجيو. تشيم. كثافة العمليات إد. 43, 5242–5246 (2004).

باتيجيلي ، إيه وآخرون. الأمونيوم والأنابيب النانوية dendron-carbon بواسطة الأمونيوم والنقر فوق الكيمياء واستخدامها لتوصيل siRNA. صغير 9, 3610–3619 (2013).

Kam ، N.W ، Liu ، Z. & amp Dai ، H. جيه. تشيم. شركة 127, 12492–12493 (2005).

وانج ، جي تي وآخرون. العلاقة بين قطر الأنابيب النانوية الكربونية متعددة الجدران والوظيفية كيميائياً وملامح التوزيع الحيوي للأعضاء في الجسم الحي. المواد الحيوية 35, 9517–9528 (2014).

Cifuentes-Rius، A. et al. المصير في الجسم الحي للأنابيب النانوية الكربونية ذات الخصائص الفيزيائية والكيميائية المختلفة لتطبيقات توصيل الجينات. تطبيق ACS. ماتر. واجهات 9, 11461–11471 (2017).

مونك ، م وآخرون. التوصيل الفعال للحمض النووي إلى أجنة الأبقار قبل الغرس بواسطة الأنابيب النانوية الكربونية متعددة الجدران. علوم. اعادة عد. 6, 33588 (2016).

Maeda-Mamiya، R. et al. تسليم الجينات في الجسم الحي بواسطة الفوليرين رباعي الأمينية. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 107, 5339–5344 (2010).

Sigwalt ، D. et al. توصيل الجينات مع مقاربات الفوليرين السداسية المتعددة التكوينات. تشيم. كومون. 47, 4640–4642 (2011).

وانج ، جيه وآخرون. إطلاق العصارة الخلوية المرئي بتبديل الضوء من siRNA بواسطة مشتق الفوليرين البرمائي لتعزيز فعالية RNAi في المختبر وفي الجسم الحي. اكتا بيوماتر. 59, 158–169 (2017).

دويدار ، م ، عبد الحميد ، هـ. ن. ، هالبرينك ، م ، زو ، إكس. وأمبير لانجل ، Ü. صفائح نانوية من أكسيد الجرافين في مجمع مع ببتيدات تخترق الخلايا لتسليم أليغنوكليوتيدات. بيوكيم. بيوفيز. اكتا 1861, 2334–2341 (2017).

تشو ، زد وآخرون. الهروب الداخلي السريع للألماس النانوي الشائك: الآثار المترتبة على توصيل الجينات. علوم. اعادة عد. 5, 11661 (2015).

ليم ، دي جي وآخرون. الألماس النانوي المزخرف من مادة البولي أميدامين كناقل هجين لتوصيل الجينات والتوصيف الهيكلي لـ siRNA في الواجهات المشحونة. تطبيق ACS. ماتر. واجهات 9, 31543–31556 (2017).

تشانغ ، X.Q. وآخرون. منصات الماس النانوي البوليمرية الوظيفية كوسائل لتوصيل الجينات. ACS نانو 3, 2609–2616 (2009).

Chen، M. et al. نواقل الماس النانوي وظيفية مع البولي إيثيلين أمين لتسليم سيرنا. J. فيز. تشيم. بادئة رسالة. 1, 3167–3171 (2010).

يي ، واي وآخرون. التسليم الجهازي المستهدف لـ siRNA لنموذج سرطان عنق الرحم باستخدام جزيئات الذهب النانوية أحادية التركيب المركبة من نوع RGD. J. التحكم. يطلق 244, 247–256 (2016).

Conde، J.، Oliva، N.، Zhang، Y. & amp Artzi، N. ينتج عن العلاج الثلاثي المركب المحلي انحدار الورم ويمنع التكرار في نموذج سرطان القولون. نات. ماتر. 15, 1128–1138 (2016).

لي ، واي وآخرون. توصيل NGF siRNA بمساعدة مجموعات النانو الذهبية لعلاج فعال لسرطان البنكرياس. نات. كومون. 8, 15130 (2017).

Cutler، J. I.، Auyeung، E. & amp Mirkin، C. A. Spherical nucleic acids. جيه. تشيم. شركة 134, 1376–1391 (2012).

رانديريا ، ب.س وآخرون. عكست الأحماض النووية الكروية المستندة إلى siRNA التئام الجروح الضعيفة في الفئران المصابة بداء السكري عن طريق ضربة قاضية لـ ganglioside GM3 synthase. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 112, 5573–5578 (2015).

سيتا ، ت.ل وآخرون. تلألؤ بيولوجي مزدوج ومراقبة التألق بالأشعة تحت الحمراء القريبة لتقييم نشاط اقتران الحمض النووي الكروي في الجسم الحي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 114, 4129–4134 (2017).

لي ، ن وآخرون. تسليم siRNA الموجه نوويًا لإسكات الجينات على المدى الطويل. تشيم. علوم. 8, 2816–2822 (2017). توضح هذه الورقة تأثير التوزيع الخلوي للبضائع على مدة إسكات الجين.

روج ، جيه. ل. وآخرون. Ribozyme - أحماض نووية كروية. جيه. تشيم. شركة 137, 10528–10531 (2015).

روان ، دبليو وآخرون. nanoclew قالب أحماض نووية كروية لتوصيل سيرنا. تشيم. كومون. 54, 3609–3612 (2018).

كالابريس ، سي إم وآخرون. المتوافقة حيويا - التنسيق اللانهائي - البوليمر الجسيمات النانوية - الحمض النووي - اتحادات لتنظيم الجينات المضادة المعنى. انجيو. تشيم. كثافة العمليات إد. 54, 476–480 (2015).

Banga ، R. J. ، Chernyak ، N. ، Narayan ، S. P. ، Nguyen ، S. T. & amp Mirkin ، C. A. Liposomal spherical nucleic acids. جيه. تشيم. شركة 136, 9866–9869 (2014).

لي ، هـ وآخرون. أحماض نووية كروية جزيئية. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 115, 4340–4344 (2018).

مولر ، ك وآخرون. توصيل siRNA عالي الكفاءة من جسيمات السيليكا النانوية المتوسطة المسامية مع أغطية بوليمر متعددة الوظائف. مقياس النانو 8, 4007–4019 (2016).

شين ، جيه وآخرون. حاملة سيليكون ذات مسام نانوية عالية السعة للتوصيل المنهجي لعلاجات إسكات الجينات. ACS نانو 7, 9867–9880 (2013).

Kapilov-Buchman، Y.، Lellouche، E.، Michaeli، S. & amp Lellouche، J. P. تعديل سطح فريد لجسيمات السيليكا النانوية مع بولي إيثيلين أمين (PEI) لتسليم siRNA باستخدام كيمياء تنسيق كاتيون السيريوم. Bioconjug. تشيم. 26, 880–889 (2015).

شين ، جيه وآخرون. تغليف متعدد الخطوات للعلاج الكيميائي وعوامل إسكات الجينات في جزيئات السيليكا النانوية المسامية. مقياس النانو 9, 5329–5341 (2017).

هي ، سي ، لو ، ك ، ليو ، د. وأمبير لين ، دبليو. الأطر المعدنية العضوية النانوية للتوصيل المشترك لسيسبلاتين و siRNAs المجمعة لتعزيز الفعالية العلاجية في خلايا سرطان المبيض المقاومة للأدوية. جيه. تشيم. شركة 136, 5181–5184 (2014).

تشين وآخرون. الجسيمات النانوية ذات الإطار المعدني العضوي المسامي المزين Se / Ru لتوصيل siRNAs المجمعة لعكس مقاومة الأدوية المتعددة في خلايا سرطان الثدي المقاومة للتاكسول. تطبيق ACS. ماتر. واجهات 9, 6712–6724 (2017).

تييري ، إيه آر وآخرون. توصيف توصيل الجينات الجسيمية: التعبير والثبات والحرائك الدوائية للبلازميد DNA. الجين هناك. 4, 226–237 (1997).

Tsui ، N. B. ، Ng ، E.K & amp Lo ، Y. M. استقرار الحمض النووي الريبي الداخلي المنشأ والمضاف في عينات الدم ، والمصل ، والبلازما. كلين. تشيم. 48, 1647–1653 (2002).

Sahin، U.، Karikó، K. & amp Türeci، Ö. العلاجات القائمة على mRNA - تطوير فئة جديدة من الأدوية. نات. القس اكتشاف المخدرات. 13, 759–780 (2014).

لايزر ، جيه إم وآخرون. في النشاط الحي من siRNAs المقاومة للنوكلياز. RNA 10, 766–771 (2004).


إنتاج ناقلات الفيروسات المرتبطة بالغدة في مكدسات الخلايا للدراسات قبل السريرية في النماذج الحيوانية الكبيرة

نواقل الفيروس المرتبطة بالغدة (AAV) هي من بين ناقلات العلاج الجيني الأكثر تقدمًا سريريًا ، مع ثلاثة علاجات جينية AAV معتمدة للبشر. يتضمن التقدم السريري للتطبيقات الجديدة لـ AAV الانتقال من نماذج حيوانية صغيرة ، مثل الفئران ، إلى نماذج حيوانية أكبر ، بما في ذلك الكلاب والأغنام والرئيسيات غير البشرية. أحد القيود المفروضة على إعطاء AAV للحيوانات الأكبر حجمًا هو الحاجة إلى كميات كبيرة من الفيروسات عالية العيار. في حين أن زراعة الخلايا المعلقة هي طريقة قابلة للتطوير لإنتاج ناقلات AAV ، إلا أن القليل من مختبرات الأبحاث لديها المعدات (على سبيل المثال ، المفاعلات الحيوية) أو تعرف كيفية إنتاج AAV بهذه الطريقة. علاوة على ذلك ، غالبًا ما يكون التتر AAV أقل بشكل ملحوظ عند إنتاجه في خلايا HEK 293 المعلقة مقارنة بخلايا HEK293 الملتصقة. الموصوفة هنا هي طريقة لإنتاج كميات كبيرة من AAV عالي العيار باستخدام مكدسات الخلايا. تم أيضًا وصف بروتوكول مفصل لمعايرة AAV بالإضافة إلى طرق التحقق من نقاء ناقل الحركة. أخيرًا ، يتم عرض النتائج التمثيلية للتعبير الجيني بوساطة AAV في نموذج الأغنام. سيمكن هذا البروتوكول المُحسَّن للإنتاج على نطاق واسع لناقلات AAV في الخلايا الملتصقة مختبرات البيولوجيا الجزيئية من المضي قدمًا في اختبار علاجاتها الجديدة AAV في نماذج حيوانية أكبر.

مقدمة

حقق العلاج الجيني باستخدام ناقلات الفيروسات المرتبطة بالغدة (AAV) خطوات كبيرة على مدى العقود الثلاثة الماضية 1 ، 2. أدت التحسينات المثبتة في مجموعة متنوعة من الأمراض الوراثية ، بما في ذلك العمى الخلقي ، والهيموفيليا ، وأمراض الجهاز العضلي الهيكلي والجهاز العصبي المركزي ، إلى جعل العلاج الجيني AAV في طليعة الأبحاث السريرية 3 ، 4. في عام 2012 ، وافقت وكالة الأدوية الأوروبية (EMA) على Glybera ، وهو ناقل AAV1 يعبر عن ليباز البروتين الدهني (LPL) لعلاج نقص LPL ، مما يجعله أول ترخيص تسويق للعلاج الجيني في أوروبا أو الولايات المتحدة 5. منذ ذلك الحين ، حصل نوعان إضافيان من علاجات الجينات AAV ، وهما Luxturna 6 و Zolgensma 7 ، على موافقة إدارة الأغذية والعقاقير (FDA) ، ومن المتوقع أن يتوسع السوق بسرعة خلال السنوات الخمس المقبلة مع توقع ما يصل إلى 10-20 علاجًا جينيًا بحلول عام 2025 8. تشير البيانات السريرية المتاحة إلى أن العلاج الجيني AAV هو طريقة آمنة وجيدة التحمل وفعالة مما يجعلها واحدة من أكثر النواقل الفيروسية الواعدة ، مع أكثر من 244 تجربة إكلينيكية تتضمن AAV مسجلة في ClinicalTrials.gov. يتطلب الاهتمام المتزايد بالتطبيقات السريرية التي تتضمن نواقل AAV أساليب إنتاج قوية وقابلة للتطوير لتسهيل تقييم علاجات AAV في النماذج الحيوانية الكبيرة ، حيث تعد هذه خطوة حاسمة في خط أنابيب الترجمة 9.

بالنسبة لإنتاج ناقلات AAV ، فإن المطلبين الرئيسيين هما جينوم AAV والقفيصة. إن جينوم النوع البري (wt) -AAV عبارة عن DNA أحادي السلسلة يبلغ طوله حوالي 4.7 كيلو بايت 10. يشتمل جينوم wt-AAV على تكرارات طرفية مقلوبة (ITRs) موجودة في طرفي الجينوم ، وهي مهمة للتعبئة ، و اعادة عد و قبعة الجينات 11 . ال اعادة عد و قبعة تتم إزالة الجينات الضرورية لتكرار الجينوم ، وتجميع القفيصة الفيروسية ، وتغليف الجينوم في القفيصة الفيروسية ، من الجينوم الفيروسي ويتم توفيرها في الترانس لإنتاج ناقلات AAV. توفر إزالة هذه الجينات من الجينوم الفيروسي مساحة للجينات العلاجية المحورة وجميع العناصر التنظيمية اللازمة ، بما في ذلك المروج وإشارة بولي أ. تظل ITRs في جينوم الناقل لضمان تكرار الجينوم المناسب والتغليف الفيروسي 13 ، 14. لتحسين حركية التعبير الجيني ، يمكن هندسة جينومات ناقل AAV لتكون مكملة ذاتيًا ، مما يخفف من الحاجة للتحويل من تحويل الحمض النووي أحادي السلسلة إلى تحويل الحمض النووي المزدوج الشريطة أثناء تكرار جينوم AAV ، ولكنه يقلل من قدرة الترميز إلى

بعد تصميم الجينوم AAV ، يحدد اختيار النمط المصلي قفيصة الأنسجة والخلية المدارية لناقل AAV في الجسم الحي 2. بالإضافة إلى استوائية الأنسجة ، تم عرض أنماط مصلية مختلفة لـ AAV لعرض حركيات التعبير الجيني المختلفة 16. على سبيل المثال ، Zincarelli et al. صنف 17 & # 160 الأنماط المصلية المختلفة لـ AAV إلى أنماط مصلية منخفضة التعبير (AAV2 ، 3 ، 4 ، 5) ، أنماط مصلية ذات تعبير معتدل (AAV1 ، 6 ، 8) ، وأنماط مصلية عالية التعبير (AAV7 و 9). قاموا أيضًا بتصنيف الأنماط المصلية لـ AAV إلى تعبير بطيء البداية (AAV2 ، 3 ، 4 ، 5) أو تعبير سريع البداية (AAV1 ، 6 ، 7 ، 8 ، 9).ترجع هذه المدارات المتباينة وحركية التعبير الجيني إلى اختلافات الأحماض الأمينية في بروتينات القفيصة ، وتكوينات البروتين القفيصة ، والتفاعلات مع مستقبلات الخلايا المضيفة / المستقبلات المشتركة. تحتوي بعض كبسولات AAV على خصائص مفيدة إضافية مثل القدرة على عبور الحاجز الدموي الدماغي بعد تناوله داخل الأوعية (AAV9) أو الإقامة في خلايا العضلات طويلة العمر للتعبير الدائم عن التحوير (AAV6 ، 6.2FF ، 8 ، 9) 19، 20 .

تهدف هذه الورقة إلى تفصيل طريقة فعالة من حيث التكلفة لإنتاج نواقل AAV عالية النقاء وعالية الجودة وذات درجة بحثية لاستخدامها في نماذج الحيوانات الكبيرة قبل السريرية. يتم تحقيق إنتاج AAV باستخدام هذا البروتوكول باستخدام تعداء البلازميد المزدوج في 293 خلية جنينية بشرية ملتصقة (HEK) نمت في مداخن الخلايا. علاوة على ذلك ، تصف الدراسة بروتوكولًا لتنقية كروماتوغرافيا تقارب كبريتات الهيبارين ، والتي يمكن استخدامها للأنماط المصلية لـ AAV التي تحتوي على مجالات ربط الهيبارين ، بما في ذلك AAV2 ، 3 ، 6 ، 6.2FF ، 13 ، و DJ 21 ، 22.

يتوفر عدد من أنظمة التغليف لإنتاج ناقلات AAV. من بين هؤلاء ، استخدام أنظمة تعداء مشتركة ثنائية البلازميد ، حيث يكون اعادة عد و قبعة الجينات وجينات مساعد Ad (E1A ، E1B55K ، E2A ، E4orf6 ، و VA RNA) موجودة في بلازميد واحد (pHelper) ، لها بعض المزايا العملية على طريقة تعداء البلازميد الثلاثة الشائعة (الثلاثية) ، بما في ذلك انخفاض تكلفة إنتاج البلازميد 23 ، 24. يجب أن يحاط بلازميد جينوم AAV الذي يحتوي على كاسيت التعبير الجيني (pTransgene) بـ ITRs ، ويجب ألا يتجاوز

4.7 كيلوبايت في الطول. يمكن أن يتأثر معدل النواقل والنقاء بالتحول الجيني بسبب التأثيرات السامة للخلايا المحتملة أثناء تعداء العدوى. تم وصف تقييم نقاء ناقلات الأمراض هنا. تم تقييم النواقل المنتجة باستخدام هذه الطريقة ، والتي تنتج 1 × 10 13 فولت / مل لكل منها ، في نماذج الفئران والهامستر وحيوانات الأغنام.

الجدول 1: تكوين الحلول المطلوبة. المعلومات الضرورية ، بما في ذلك النسب المئوية والأحجام ، للمكونات اللازمة للحلول المختلفة في جميع أنحاء البروتوكول. الرجاء النقر هنا لتنزيل هذا الجدول.

الاشتراك المطلوبة. يرجى التوصية بـ JoVE لأمين المكتبة الخاص بك.

بروتوكول

1. تعداء بلازميد مزدوج لخلايا HEK293 في مداخن الخلايا

  1. قم بإذابة قنينة التبريد المكونة من خلايا HEK293 في حمام خرز عند 37 & # 176 درجة مئوية.
    ملاحظة: DMEM الكامل للتدفئة المسبقة إلى 37 & # 176 درجة مئوية أثناء ذوبان الخلايا لضمان أن درجة الحرارة الباردة لا تصدم الخلايا عند الطلاء. تأكد من أن الخلايا لديها عدد ممر منخفض ، من الناحية المثالية أقل من 20 ، لضمان النمو الأمثل وكفاءة تعداء. تأكد من أن الخلايا معتمدة على أنها خالية من الميكوبلازما.
  2. نقل محتويات قنينة التبريد دروبويز إلى أنبوب مخروطي سعة 15 مل يحتوي على 10 مل من DMEM الكامل الذي تم تسخينه مسبقًا والطرد المركزي للخلايا عند 500 × ز لمدة 5 دقائق.
  3. نضح وسائل الإعلام ، ومن ثم إعادة تعليق خلايا HEK293 في 20 مل من DMEM الكامل الذي تم تسخينه مسبقًا. زرع الخلايا في لوحة 15 سم واحتضانها في 37 & # 176 درجة مئوية ، مع 5 ٪ CO2.
  4. تقسيم الخلايا من لوحة واحدة 15 سم إلى ثلاثة للبذر في غرفة زراعة الخلية.
    1. بمجرد أن تكون الخلايا متكدسة بنسبة 80٪ ، نضح الوسائط وغسل اللوحة برفق باستخدام 3 مل من برنامج تلفزيوني لعدم تعطيل الطبقة الأحادية. ثم نضح برنامج تلفزيوني وإضافة 3 مل من التربسين.
    2. احتضان لمدة 2 دقيقة عند 37 & # 176 درجة مئوية حتى ترفع الخلايا من اللوحة ، ثم تحييد التربسين بإضافة 7 مل من DMEM الكامل إلى اللوحة.
    3. جمع كل الوسائط والخلايا في أنبوب 15 مل وتكوير الخلايا بالطرد المركزي في 500 × ز لمدة 5 دقائق.
    4. نضح المادة طافية من أنبوب 15 مل وريسوسبيند بيليه الخلية في 3 مل DMEM كاملة. إضافة 1 مل إلى كل لوحة 15 سم تحتوي على 20 مل من DMEM كاملة الصخور بلطف لتوزيع الخلايا بالتساوي ، واحتضان في 37 & # 176C ، مع 5٪ CO2.

    حضانة لمدة 65 ساعة ، تحقق من اللوحة المرجعية للالتقاء - بشكل مثالي


    شكل 1: مناورة كومة الخلايا من أجل بذر الخلايا وترنسفكأيشن. لبذر مكدس الخلايا ، ابدأ بإزالة أحد أغطية التهوية وصب 1 لتر من DMEM الكامل المُسخَّن مسبقًا مع الكمية المطلوبة من خلايا HEK293 (أ). قم بتوزيع الخلايا والوسائط بالتساوي عن طريق شد كل من أغطية التهوية وإحضار جميع الوسائط إلى زاوية مكدس الخلايا بأحد أغطية التهوية ووضعها في تلك الزاوية (ب) ، ضع مكدس الخلايا على جانبها (ج) ، ثم أدر مكدس الخلايا 90 & # 176 (د) بحيث تكون منافذ التهوية مرتفعة (ه). قم بخفض مكدس الخلايا برفق إلى وضعه الأفقي الطبيعي وتأكد من تغطية جميع غرف مكدس الخلايا بالكامل في الوسائط (F). عند إجراء التطهير ، قم بفك كل من أغطية التهوية وصب الوسائط القديمة ببطء في حاوية نفايات معقمة حتى لا يزعج التدفق أحادي الطبقة للخلايا (جي). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    1. تحضير خليط البولي إيثيلين أمين (PEI) / DNA بنسبة تركيز 3: 1 (وزن / وزن).
      1. تحضير خليط الحمض النووي في أنبوب مخروطي سعة 50 مل بإضافة 475 & # 181 جم من pTrangene و 1425 & # 181 جم من pHelper إلى 40 مل من وسط مصل مخفض لإنشاء نسبة 3: 1 من pHelper: pTrangene.
        ملاحظة: يمكن العثور على آلة حاسبة خليط PEI / DNA باستخدام الجدول 2.
      2. أضف 5.7 مل من PEI (1 جم / لتر) إلى وسط مصل الدم المخفّض ومزيج الحمض النووي بالتنقيط. ثم ، دوامة لفترة وجيزة واحتضانها لمدة 10 دقائق في درجة حرارة الغرفة.
        ملاحظة: نظرًا لاحتضان PEI / DNA في درجة حرارة الغرفة ، سيصبح غائمًا قليلاً.

      2 حصاد AAV والتحلل الكيميائي لخلايا HEK293 المنقولة

      1. هز غرفة زراعة الخلايا بقوة لإزاحة الخلايا حتى تظهر الوسائط غائمة من الخلايا المزاحة وتصب في أربعة أنابيب طرد مركزي سعة 500 مل.
      2. أنابيب الطرد المركزي في 18000 x ز لمدة 30 دقيقة في 4 & # 176 ج لتكوير الخلايا. صب المادة الطافية الموضحة في زجاجة 1 لتر من البولي إيثيلين تيريفثاليت كوبوليستر (PETG).
        ملاحظة: إذا لم يكن لدى أحد إمكانية الوصول إلى جهاز طرد مركزي عالي السرعة ، فإن جهاز الطرد المركزي بسرعة 12000 x ز لمدة 40 دقيقة. قد لا تكون الخلايا الحبيبية صلبة بهذه السرعة وستنزلق كطاف.
      3. أعاده تعليق الكريات الخلوية في أنابيب الطرد المركزي 500 مل مع 50 مل من المخزن المؤقت للتحلل واحتضانها لمدة 60 دقيقة عند 37 & # 176 درجة مئوية.
      4. أنابيب الطرد المركزي في 18000 x ز لمدة 30 دقيقة ، ثم انقل المادة الطافية إلى نفس زجاجة PETG سعة 1 لتر. تخلص من حطام الخلية المحبب.
        & # 8203 ملاحظة: تنقية المادة الطافية الموضحة فورًا وتخزينها في 4 & # 176 درجة مئوية لمدة تصل إلى 72 ساعة. للتخزين على المدى الطويل ، قم بالتخزين في -80 & # 176 درجة مئوية. لا تخزن في درجة حرارة -20 و # 176 درجة مئوية.

      3 تنقية ناقلات AAV باستخدام كروماتوغرافيا تقارب الهيبارين

      1. قم بإزالة المستحلب الخام من -80 & # 176 درجة مئوية واتركه في 4 & # 176 درجة مئوية بين عشية وضحاها ليذوب. بمجرد الذوبان ، استخدم مرشح 0.22 & # 181M لتصفية المحلول الخام.
      2. لتخميل مكثف الطرد المركزي ، أضف 4 مل من المخزن المؤقت للمعالجة المسبقة للفلتر إلى مكثف طرد مركزي لكل عمود سيفروز هيبارين يتم استخدامه. قم بتثبيط مكثف الطرد المركزي في درجة حرارة الغرفة لمدة 2-8 ساعات. قم بإعداد التخميل مباشرة قبل خطوات التنقية.
      3. قم بإعداد الأنبوب والمضخة (الشكل 2).
        1. ضع الأنبوب في مضخة تمعجية وقم بتشغيل 20 مل من 1 M هيدروكسيد الصوديوم. بعد ذلك ، قم بتشغيل 50 مل من الماء الجزيئي ، ثم قم بتشغيل 50 مل من DMEM الأساسي.
        2. إرفاق 5 مل عمود سيفروز الهيبارين إلى الأنابيب وتشغيل 25 مل من DMEM القاعدية لإزالة المادة الحافظة.


        الشكل 2: إعداد المضخة التمعجية لتنقية AAV. قم بتشغيل الأنبوب من المحللة الخام ، عبر المضخة التمعجية ، وفي عمود مصفوفة الهيبارين. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

        ملاحظة: تأكد من عدم إدخال فقاعات أو السماح للعمود بالتجفيف ، لأن هذا سيعرض العمود للخطر ويمنع شطف AAV. تجاهل العمود إذا كان جافًا واستخدم عمودًا جديدًا لبقية المحللة الخام.

        1. قم بتحميل كل المحلول الخام على عمود الهيبارين واستخدم الحلول التالية لغسل العمود.
          1. اغسل باستخدام 50 مل من 1x Hank & # 39s Balanced Salt Solutions (HBSS) بدون Mg 2+ و Ca 2+.
          2. اغسل باستخدام 15 مل من 0.5٪ N-Lauroylsarcosine في HBSS بدون Mg 2+ و Ca 2+.
          3. اغسل باستخدام 50 مل من HBSS بدون Mg 2+ و Ca 2+.
          4. اغسل باستخدام 50 مل من HBSS مع Mg 2+ و Ca 2+
          5. اغسل باستخدام 50 مل من 200 ملي كلوريد الصوديوم / HBSS مع Mg2 + و Ca 2 +.
          6. أزل 5 × 5 مل (إجمالي 25 مل) مع 300 ملي مولار من كلوريد الصوديوم / HBSS مع Mg 2+ و Ca 2+ وقم بتسمية الإيحاءات كـ E1-E5 (كل شطف من 5 مل).

          4 استخراج الحمض النووي الجيني AAV

          1. تحضير خليط التفاعل المذكور في الجدول 3 في أنبوب PCR لعلاج DNase.

          الجدول 3: صيغة المزيج الرئيسي لمعالجة الدناز. المكونات والأحجام الموصى بها المطلوبة لعلاج DNase لناقلات الفيروس AAV أثناء استخلاص الحمض النووي.

          1. دوامة أنبوب PCR لخلط ونبض أنبوب PCR لتدوير المحتويات.
          2. باستخدام جهاز تدوير حراري ، احتضان عند 37 & # 176 درجة مئوية لمدة 20 دقيقة تليها 75 & # 176 درجة مئوية لمدة 15 دقيقة لتسخين تعطيل DNase.
          3. أضف 5 & # 181L من بروتيناز K.
          4. باستخدام جهاز التدوير الحراري ، احتضان عند 50 & # 176 درجة مئوية لمدة 60 دقيقة ثم في 95 & # 176 درجة مئوية لمدة 30 دقيقة لتسخين تعطيل بروتين ك.
          5. استخدم مجموعة تنظيف الحمض النووي لإزالة الملوثات المحتملة.
            ملاحظة: تم تنفيذ هذه الخطوة باستخدام مجموعة أدوات تنظيف الدم والأنسجة المتاحة تجارياً (جدول المواد).
            1. أضف 200 & # 181L من AL buffer (مجموعة تنظيف الدم والأنسجة ، جدول المواد) إلى أنبوب PCR الذي يحتوي على ناقل DNase / Proteinase K.
            2. دوامة أنبوب PCR واحتضان في 56 & # 176C لمدة 10 دقيقة في جهاز التدوير الحراري.
            3. امص السائل من أنبوب PCR إلى عمود تدور معقم في أنبوب تجميع.
            4. أضف 200 & # 181L من الإيثانول 100٪ إلى العمود واخلطه جيدًا عن طريق الدوامة.
            5. الطرد المركزي في 6000 x ز لمدة 1 دقيقة وتجاهل التدفق من خلال.
            6. أضف 500 & # 181L من المخزن المؤقت AW1 (مجموعة تنظيف الدم والأنسجة ، جدول المواد) إلى عمود الدوران.
            7. الطرد المركزي في 6000 x ز لمدة 1 دقيقة وتجاهل التدفق من خلال.
            8. أضف 500 & # 181L من المخزن المؤقت AW2 (مجموعة تنظيف الدم والأنسجة ، جدول المواد) إلى عمود الدوران.
            9. جهاز طرد مركزي بسرعة 15000 x ز لمدة 3 دقائق وتجاهل التدفق من خلاله.
            10. ضع عمود الدوران في أنبوب طرد مركزي معقم 1.5 مل وأضف 200 & # 181L من المخزن المؤقت AE (مجموعة تنظيف الدم والأنسجة ، جدول المواد) مباشرة إلى غشاء عمود الدوران.
            11. احتضان في درجة حرارة الغرفة لمدة 1 دقيقة.
            12. الطرد المركزي في 6000 x زلمدة 1 دقيقة للتخلص من الحمض النووي.
            13. قم بتخزين الحمض النووي في -20 & # 176 درجة مئوية.

            5 معايرة جينومات ناقلات AAV باستخدام تفاعل البلمرة المتسلسل الكمي ومسبار Simian Virus 40 (SV40)

            ملاحظة: أداء جميع أعمال qPCR في غطاء PCR باستخدام نصائح ماصة تمت تصفيتها لتجنب تلوث الحمض النووي الخارجي. إذا كان جينوم AAV لا يشفر تسلسل SV40 polyA ، فاستخدم مسبارًا مقابل ITR الموصوف في مكان آخر 25. تأكد من أن DNA البلازميد المحدد كمعيار يحتوي على تسلسل SV40 polyA.

            1. إعداد معيار المخزون
              1. قم بتخفيف معيار الحمض النووي للبلازميد (pTransgene plasmid الذي يحتوي على تسلسل SV40 polyA) إلى تركيز نهائي قدره 10 & # 181g / & # 181L وتخزينه في -20 & # 176C في 6 & # 181L قسامات.
              2. حدد رقم النسخة الموجود في معيار DNA البلازميد باستخدام الآلة الحاسبة عبر الإنترنت التالية 26.
                ملاحظة: استخدم DNA البلازميد المستخدم للمعيار المنتج من قبل بائع تجاري لضمان الجودة والتركيز الصحيح. قم بإعداد كمية كبيرة من المعيار (على سبيل المثال ، 10 مل) لإجراء دراسات التجسير عند الانتقال إلى معيار مُعد حديثًا.

              الجدول 4: مزيج qPCR الرئيسي لمعايرة AAV. المكونات والأحجام الموصى بها المطلوبة لـ qPCR للحمض النووي المستخرج من النواقل الفيروسية AAV.

              مكون تسلسل
              التمهيدي إلى الأمام 5 & ​​# 8217-AGCAATAGCATCACAAATTTCACAA-3 & # 8217
              عكس التمهيدي 5 & ​​# 8217-CCAGACATGATAAGATACATTGATGAGTT-3 & # 8217
              مسبار / 56-FAM / AGCATTTTT / Zen / TTCACTGCATTCTAGTTGTGGTTTGTC / 3IABkFQ

              الجدول 5: متواليات التمهيدي مقابل تسلسل DNA SV40 polyA. تسلسلات من البادئات والمسبار المستخدمة لمعايرة qPCR ، والتي ترتبط بمناطق محددة من نواقل الفيروس AAV التي تحتوي على تسلسل SV40 polyA.

              1. الماصة الرئيسية تخلط لأعلى ولأسفل للمزج.
              2. قم بإعداد لوحة التخفيف.
                1. استخدم لوحة 96-بئرًا واضحة لتحضير التخفيفات القياسية والعينة ، أضف 45 & # 181 لترًا من الماء الجزيئي لكل بئر في كل عمود آخر بدءًا من العمود 1 (الأعمدة 1 و 3 و 5 و 7 و 9 و 11).
                2. أضف 5 & # 181L من المعيار إلى A1 جيدًا وماصة للخلط.
                3. استخدم طرف ماصة مفلتر جديدًا لإنشاء تخفيف 1/10 من البئر A1 إلى B1.
                4. استمر في سلسلة من التخفيفات بمقدار 10 أضعاف أسفل العمود حتى تصل إلى G1.
                5. لا تضيف إلى H1 ، لأن هذا سيعمل كعنصر تحكم سلبي.
                6. ضع العينة الأولى (S1) بإضافتها إلى البئر A3 ، وتشكيل تخفيف 1/10. امص هذا الخليط وانقل 5 & # 181L إلى البئر B3. تجاهل طرف الماصة بعد هذا النقل.
                7. باستخدام طرف ماصة جديد ، امزج المحلول في البئر B3 وشكل التخفيف 1/100. نقل 5 & # 181Lof من هذا الخليط إلى البئر C3 وتجاهل الحافة بعد النقل.
                8. مع طرف ماصة جديد ، ماصة لأعلى ولأسفل المحلول في البئر C3 لجعل التخفيف 1/1000. تجاهل الحافة.
                9. استمر في تخفيف العينات دون إضافة أي عينات إلى الأعمدة 2 أو 4 أو 6 أو 8 أو 10 أو 12.
                10. بمجرد تخفيف جميع العينات ، امزج المحتويات في آبار العمود 1 ، ثم انقل 20 & # 181L إلى العمود 2.
                11. كرر هذا للأعمدة 3 و 5 و 7 و 9 و 11 لإنشاء نسخ مكررة لكل معيار وإضعاف العينة. تشير إلى الشكل 3 لتخطيط اللوحة.
                  & # 8203 ملاحظة: عند اتباع إعداد اللوحة في الشكل 3، العينات المخففة في الصفين G و H ستحتوي فقط على تخفيف 1/10 و 1/100.


                الشكل 3: تخطيط لوحة لمعايرة QPCR AAV. يشير اللون الأزرق إلى موضع التخفيف التسلسلي للأخضر القياسي يشير إلى وضع اللون البنفسجي للتحكم السلبي في موضع تخفيف العينات. يتم إضافة كل معيار ، سلبي ، أو عينة في تكرار. تمت إضافة مثال لتركيز المعيار لإظهار سلسلة التخفيف للمعيار ، وتم إضافة موضع تخفيف العينة إلى الآبار الخاصة بكل منها. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

                1. المعايرة بواسطة qPCR SV40 polyA القائم على الكشف
                  1. أضف 15 & # 181L من المزيج الرئيسي qPCR إلى كل بئر من صفيحة qPCR بيضاء شبه متلاصقة 96 بئر.
                  2. نقل 5 & # 181L من كل عينة من لوحة 96-جيدا واضحة إلى لوحة 96 qPCR جيدا شبه متجنب.
                  3. استخدم ماصة متعددة القنوات لضمان الخلط المناسب لمزيج qPCR الرئيسي والعينة.
                  4. ختم اللوح بغشاء مانع للتسرب وجهاز طرد مركزي للوحة qPCR عند 1500 × ز لمدة 30 ثانية.
                  5. قم بتشغيل رد فعل qPCR على أداة تضخيم واكتشاف PCR في الوقت الحقيقي المستندة إلى اللوحة ، باستخدام الظروف المقترحة في الجدول 6.

                  الجدول 6: بروتوكول جهاز التدوير الحراري لمعايرة qPCR القائمة على مسبار التحلل المائي. يوصى ببروتوكول جهاز التدوير الحراري الموصى به لاستخدام معايرة qPCR القائمة على المسبار لنواقل AAV المنقى المستخرجة من الحمض النووي.

                  ملاحظة: للحصول على ورقة عمل معايرة qPCR AAV ، انظر الجدول 7.

                  1. تحليل البيانات لتحديد أرقام نسخ الجينوم AAV.
                    1. املأ خلايا بيانات جدول البيانات (الجدول 7 أ) مع قيم التركيز التي تم الحصول عليها من تشغيل qPCR لكل من التخفيفات القياسية والعينة.
                    2. استخدم قيم التركيز من الجدول 7 أ لإنتاج منحنى قياسي (الجدول 7 ب).
                      ملاحظة: سيظهر المنحنى القياسي كلوغاريتم طبيعي (ذ = أ ln (x) + ب) جنبًا إلى جنب مع كفاءة R 2. يجب أن يكون للمنحنى القياسي كفاءة قريبة من 100٪ و R 2 قريبة من 1.0 (& # 88050.99).
                    3. املأ كفاءة المنحدر بملء هذه الآلة الحاسبة عبر الإنترنت 27.
                      ملاحظة: كفاءة بين 90٪ -110٪ مقبولة. إذا كانت كفاءة qPCR خارج هذا النطاق ، فأعد تشغيل qPCR.
                    4. استخدم قيم التركيز من الجدول 7 أ لحساب متوسط ​​التخفيفات لكل عينة وتحديد الانحراف المعياري لكل عينة (الجدول 7 ج).
                      ملاحظة: استبعد التخفيفات من العينات التي تكون أكثر من انحراف معياري بعيدًا عن متوسط ​​التخفيفات العينة.
                    5. باستخدام متوسط ​​تركيز كل تخفيف ، اضرب في عامل التخفيف ، ثم اقسم على خمسة للحصول على جينومات المتجه (vg) / & # 181L لكل عينة (الجدول 7 ج).
                    6. احسب vg / mL لكل عينة بضرب متوسط ​​كل عينة وتركيزات # 39 في 80000 (الجدول 7C).
                    7. متوسط ​​vg / mL لكل تخفيف لإنتاج vg / mL النهائي لكل عينة (الجدول 7 ج).
                      & # 8203 ملاحظة: يجب على المستخدم قسمة متوسط ​​تركيز كل تخفيف على عامل خمسة لحساب 5 & # 181L الذي تم تحميله في كل بئر لتشغيل qPCR لإنتاج التركيز في vg / & # 181L. عامل 80000 حسابات للانتقال من كل عينة & # 39 يعني قيمة التركيز إلى vg / mL. أولاً ، يجب مضاعفة متوسط ​​قيمة كل عينة & # 39 s التركيز في 2 لحساب الجينوم أحادي الجديلة ، حيث أن مجموعة المسبار التمهيدي تحدد فقط الحس الإيجابي ، والحمض النووي أحادي الجديلة (ssDNA) ، وجينوم AAV موجود في نسبة تقريبية 1: 1 بين ssDNA الموجب والسالب 25 ، 28. يجب مضاعفة متوسط ​​كل عينة & # 39 s قيمة التركيز × 40 لحساب تخفيف العينة من 5 & # 181L من الناقل المنقى (القسم 4.1) إلى 200 & # 181L من الحمض النووي المستخرج (القسم 4.6.12). أخيرًا ، يجب مضاعفة متوسط ​​قيمة كل عينة & # 39 s تركيز x1000 للتحويل من vg / & # 181L إلى vg / mL.

                    6 تقييم جودة النواقل ونقاوتها

                    1. مراقبة الجودة - لطخة ويسترن
                      1. تحضير هلام 12٪ SDS PAGE.
                      2. إجراء التفريد بولي أكريلاميد هلام.
                        ملاحظة: قم بتحميل 6 × 10 10 ميكروغرام من العينات لكل بئر.
                      3. نقل البروتينات إلى غشاء بوليفينيليدين ديفلوريد (PVDF).
                      4. حجب غشاء PVDF
                        1. قم بإزالة الغشاء من جهاز النقل وشطفه في 0.1٪ PBST لإزالة مادة الأكريلاميد السائبة.
                        2. ضع الغشاء في محلول الحجب لمدة ساعة واحدة على الأقل في درجة حرارة الغرفة أو بين عشية وضحاها عند 4 & # 176 درجة مئوية.
                          ملاحظة: يمكن استكمال حظر المخزن المؤقت بمصل الماعز بنسبة 2٪.
                        1. صب المخزن المؤقت للحظر وإضافة الجسم المضاد الأساسي ، وهو جسم مضاد أحادي النسيلة مضاد للفأر AAV بتخفيف 1: 200.
                        2. احتضان بين عشية وضحاها في 4 & # 176C.
                        3. صب الجسم المضاد الأولي ويغسل خمس مرات مع 0.1٪ PBST لمدة 5 دقائق في درجة حرارة الغرفة مع التحريك.
                        1. صب محلول الغسيل وأضف جسم مضاد ثانوي مترافق لـ HRP ، مخفف عند 1: 7500 في محلول منع ، واحتضانه لمدة 1 ساعة في درجة حرارة الغرفة مع التحريك.
                        2. صب الجسم المضاد الثانوي ويغسل خمس مرات مع 0.1٪ PBST لمدة 5 دقائق في درجة حرارة الغرفة مع التحريك.
                        3. إجراء غسل نهائي مع برنامج تلفزيوني في درجة حرارة الغرفة مع التحريك.


                        الشكل 4: لطخة غربية تظهر بروتينات قفيصة AAV. سلم حارة A MW ، حارة B AAV6.2FF-hIgG01 ، حارة C AAV6.2FF-hIgG02 ، حارة D AAV6.2FF-hIgG03 ، وخط E AAV6.2FF-hIgG04. تم تحميل 6 × 10 10 vg من كل AAV6.2FF-hIgG في الممرات الخاصة بها. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

                        1. التحكم في النقاء - SDS PAGE و Coomassie Stain
                          1. تحضير هلام SDS-PAGE والعينات كما هو موضح من الخطوة 6.1.1 و 6.1.2.
                          2. إصلاح الجل في محلول التثبيت لمدة 1 ساعة أو بين عشية وضحاها مع التحريض اللطيف. قم بتغيير محلول التثبيت مرة واحدة خلال الساعة الأولى.
                          3. وصمة الجل في محلول تلطيخ لمدة 2-4 ساعات مع التحريك اللطيف.
                          4. قم بإزالة الجل بمحلول تقطير. قم بتجديد محلول التكسير عدة مرات حتى يتم التخلص من خلفية الجل بالكامل (4-24 ساعة).
                          5. قم بتخزين الجل في محلول تخزين.
                          6. صورة الجل لتصور جميع البروتينات الملطخة بمحلول تلطيخ كوماسي.


                          الشكل 5: هلام ملطخ كوماسي. سلم لين A MW ، لين B AAV6.2FF-hIgG01 ، لين C AAV6.2FF-hIgG02 ، لين D AAV6.2FF-hIgG03 ، لين E AAV6.2FF-hIgG04 ، لين F AAV6.2FF-hIgG05 ، ولين G AAV6. 2FF-hIgG06. تم تحميل 6 × 10 10 vg من كل AAV6.2FF-hIgG في الممرات الخاصة بها. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

                          1. مقايسة التحكم في النقاء البديل - HEK293 الكشف عن بروتين الخلية المضيفة ELISA
                            1. قم بإجراء الكشف عن بروتين الخلية المضيفة HEK293 عبر ELISA وفقًا لتعليمات الشركة المصنعة & # 39s.
                              ملاحظة: استخدم التخفيفات 5 × 10 -2 و 1 × 10 -3 لعينات rAAV المنقى. بمجرد إضافة TMB إلى البئر ، احضنه بعيدًا عن الضوء. لا يمكن استخدام الانحدار الخطي لتحليل النتائج.
                            2. قم بإجراء تحليل من نقطة إلى نقطة ، أو شريحة مكعبة ، أو طريقة ملائمة لوجستية من أربعة معلمات لاستيفاء تركيزات مجهولة وضربها في عامل التخفيف لتحديد تركيز العينة الأصلي.

                            الاشتراك المطلوبة. يرجى التوصية بـ JoVE لأمين المكتبة الخاص بك.

                            نتائج الممثل

                            تمثل الترجمة من نماذج القوارض الصغيرة إلى نماذج حيوانية أكبر والتطبيق السريري في نهاية المطاف تحديًا كبيرًا بسبب الكمية الكبيرة من AAV المطلوبة لتحويل الحيوانات الكبيرة وتحقيق التأثيرات العلاجية. لمقارنة كفاءة التحويل لقفيصة AAV6.2FF المصممة بشكل عقلاني ، أظهرت سابقًا زيادة بمقدار 101 ضعف في كفاءة التحويل في خلايا عضلات الفئران مقارنةً بـ AAV6 3 ، تم إعطاء الفئران والهامستر والحملان جميعًا AAV6.2FF معربًا عن جسم مضاد أحادي النسيلة بشري ( hIgG). احتوى المتجه المعبر عن AAV6.2FF-hIgG على مروج CASI 4 ، وعنصر تنظيمي لما بعد النسخ من فيروس Woodchuck (WPRE) ، وتسلسل SV40 polyA. تم إعطاء فئران BALB / c البالغة من العمر ستة أسابيع (ن = 4) عضليًا (IM) 1 × 10 11 vg من AAV6.2FF-hIgG في 40 & # 181L ، وتم جمع الدم في الأيام 0 ، 7 ، 14 ، 21 و 28 بعد إدارة AAV لرصد hIgG. تم إعطاء الهامستر السوري البالغ من العمر أربعة أسابيع (إناثان وذكوران) IM 1 × 10 12 vg من AAV6.2FF-hIgG في 40 & # 181L ، وتم جمع الدم أسبوعيًا لمراقبة تعبير hIgG. أخيرًا ، تم إعطاء الحملان الذكور البالغة من العمر 10 أيام (ن = 3) IM 1 × 10 13 فولت / كجم من AAV6.2FF-hIgG في 2 إلى 3 حقن 1 مل في الردف. تم الانتهاء من جمع الدم الأسبوعي عن طريق النزيف الوداجي وتم مراقبة hIgG أسبوعياً لمدة 28 يومًا. تمت الموافقة على جميع التجارب على الحيوانات من قبل لجنة رعاية الحيوان المؤسسية بجامعة جيلف.

                            أعطت الفئران IM 5 x 10 12 vg / kg من AAV6.2FF-hIgG معبرًا عنها بين 171-237 & # 181g / mL من hIgG في المصل بحلول اليوم 28 بعد الإدارة (الشكل 6). أظهر الهامستر IM 2 × 10 13 vg / kg من AAV6.2FF-hIgG مستويات أعلى بكثير من الفئران ، مع مستويات hIgG في الدم من 495-650 & # 181 جم / مل في اليوم 28 بعد الإدارة. أخيرًا ، أعطت الأغنام IM 1 × 10 13 vg / kg مستويات hIgG في المصل من 21-46 & # 181g / mL في اليوم 28 بعد الإعطاء. في جميع النماذج الحيوانية ، لا يبدو أن الناقل يعيق أي مؤشرات صحية ، مثل الوزن ، مما يثبت سلامة وجودة النواقل المنتجة. من المعروف جيدًا أن تعبير الجسم المضاد أحادي النسيلة (mAb) بوساطة AAV يختلف اختلافًا كبيرًا اعتمادًا على الأنواع و mAb. وفقًا لأفضل معرفة المؤلفين ، لا توجد تقارير عن تعبير AAV-mAb في أنواع الأغنام ، وبالتالي لا يوجد معيار لمستويات التعبير المتوقعة. يشار إلى أن الأغنام في هذه الدراسة تضاعف وزنها خلال فترة 28 يومًا بعد الحقن وأن الحيوانات في الشكل 6 تم نقلها جميعًا باستخدام AAV-mAbs مختلفة وبالتالي لا يمكن مقارنتها.


                            الشكل 6: يؤدي التوصيل العضلي لـ AAV6.2FF-hIgG إلى استمرار تعبير hIgG في الدم في الفئران والهامستر والأغنام. تم إعطاء الفئران الإناث BALB / c (ن = 4) IM 5 x 10 12 vg / kg من AAV6.2FF-hIgG ، الهامستر السوري (2 ذكور ، 2 إناث) ، تم إعطاؤها IM 1 × 10 13 vg / kg من AAV6. تم إعطاء 2FF-hIgG ، وحملان Dorset الذكور البالغة من العمر 10 أيام (ن = 3) IM 1 × 10 13 vg / kg. تمت مراقبة المصل من أجل تعبير hIgG على مدار 28 يومًا. يتم تمثيل البيانات على أنها المتوسط ​​& # 177 الانحراف المعياري. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

                            تعداء غرفة ثقافة الخلية
                            بروتوكول
                            1. السماح للحمض النووي ، OptiMEM و PEI بالتدفئة إلى درجة حرارة الغرفة قبل تعداء الجسم
                            2. أدخل عدد مكدسات الخلايا المراد نقلها (لا يلزم وجود تجاوزات)
                            3. تأكد من أن تركيزات الحمض النووي صحيحة لأن هذا سيغير الكميات المطلوبة
                            عدد غرف ثقافة الخلية 1
                            تركيز البلازميد المعدلة وراثيا 1 ملغ / مل
                            تركيز البلازميد pDGM6.2FF 1 ملغ / مل
                            كمية غرف زراعة الخلايا تعداء Mastermix
                            OptiMEM 48.1 مل 48.1 مل
                            نسبة 1: 3 pTransgene: pHelper ع ترانسجين 475 & # 181 جرام 475 & # 181L
                            فهلبر 1425 & # 181 جرام 1425 & # 181L
                            4. إضافة الأحجام المطلوبة من OptiMEM و DNA البلازميد إلى أنبوب مخروطي 50 مل
                            5. اقلبها 10 مرات للخلط
                            3: 1 PEI: نسبة الحمض النووي PEI ماكس 5.7 مل 5.7 مل
                            6. أضف الكمية المطلوبة من PEI إلى أنبوب سعة 50 مل يحتوي على OptiMEM و DNA البلازميد
                            7. أغلق الأنبوب 50 مل والدوامة على الفور واقلب 3 مرات و # 82115 مرات للخلط.
                            8. تعيين جهاز توقيت لمدة 10 دقيقة لاحتضان المجمعات جزيرة الأمير إدوارد
                            9. نقل مداخن الخلايا ليتم نقلها إلى BSC
                            10. بعد 10 دقائق ، صب خليط العدوى في منفذ برتقالي واحد.
                            11. قم بخلط السائل برفق في جميع أنحاء مجموعة الخلايا
                            12. & # 160 إعادة كومة الخلايا المنقولة إلى الحاضنة لضمان حجم متساوٍ في كل طبقة
                            13. غرفة زراعة خلية الحصاد 72 ساعة في وقت لاحق

                            الجدول 2: آلة حاسبة تعداء لغرفة زراعة الخلايا. ورقة عمل تفاعلية لتحديد التركيز الصحيح لـ pTransgene و pHelper و PEI لترنسفكأيشن غرفة زراعة الخلايا.

                            الجدول 7: حاسبة المعايرة بالتحليل الحجمي AAV. ورقة عمل تفاعلية لتحديد التركيز النهائي لعينات AAV من qPCR ، معبرًا عنها بـ vg / mL. الرجاء النقر هنا لتنزيل هذا الجدول.

                            الاشتراك المطلوبة. يرجى التوصية بـ JoVE لأمين المكتبة الخاص بك.

                            مناقشة

                            يستخدم إنتاج نواقل AAV المؤتلف (rAAV) الموصوفة في هذه الورقة مواد شائعة وكواشف ومعدات موجودة في غالبية مختبرات ومنشآت أبحاث البيولوجيا الجزيئية. تسمح هذه الورقة بجودة عالية في المختبر و في الجسم الحي الصف rAAV ليتم إنتاجه بواسطة القارئ. قبل كل شيء ، يعتبر هذا البروتوكول لإنتاج rAAV ، مقارنة بالبروتوكولات الأكثر مملة التي تتضمن تنقية كلوريد السيزيوم ، فعالاً ويتجنب استخدام التنبيذ الفائق. بمجرد نقل خلايا HEK293 ، يصبح AAV المنقى جاهزًا للاستخدام في غضون 5 أيام عمل.

                            أثناء عملية إنتاج وتنقية rAAV ، يمكن أن تؤثر العديد من الخطوات على نقاء والعيار النهائي للناقل. الخطوة الأولى والأكثر أهمية هي صحة خلايا HEK293 ، والتي لها تأثير مباشر على عيار ناقل. يعد استخدام خلايا HEK293 بدلاً من أنواع أو أنظمة الخلايا الأخرى ، مثل خلايا HEK293T ، مفيدًا لأن خلايا HEK293 تتمتع بقدرة أكبر على الالتصاق بالطلاء البلاستيكي للألواح والخلايا التي تنشئ شبكات خلايا قوية للنمو المستمر للخلايا. يوصى بمراقبة الخلايا لتلوث الميكوبلازما وتجنب مرور خلايا HEK293 في الماضي

                            40 مقطعًا أو مرة واحدة يبدو أن وقت المضاعفة يتباطأ لأن هذا سيؤدي إلى انخفاض عوائد AAV. علاوة على ذلك ، فإن الخلايا المؤكدة تكون متكدسة بنسبة 80٪ تقريبًا قبل تعداء العدوى مما يضمن أن الخلايا ليست متناثرة جدًا أو متضخمة. فيما يتعلق بمكونات تعداء ، يوصى بشدة باستخدام DNA البلازميد عالي الجودة (على سبيل المثال ، DNA البلازميد المحضر تجاريًا) لضمان بقاء الحمض النووي في المحلول ويتفاعل بشكل صحيح مع مكونات توصيل تعداء العدوى الكيميائية ، مثل PEI. أخيرًا ، كاشف تعداء له تأثير كبير على عائدات rAAV. هنا ، يتم استخدام PEI كعامل تعداء. PEI عبارة عن بوليمر كاتيوني مستقر يسلم الحمض النووي الخارجي إلى نواة الخلايا من خلال إنتاج معقدات بلازميد بوليمر ، والتي تلتقطها الخلايا بعد ذلك وتنتقل إلى النواة من خلال عمليات الخلية المضيفة 29. تعتبر عمليات العدوى المستندة إلى PEI سريعة وسهلة مقارنة بالطرق الأخرى لتوصيل الحمض النووي ، بما في ذلك فوسفات الكالسيوم أو الليبوفكتامين. ومع ذلك ، يجب تحسين نسبة PEI: DNA.

                            يوفر استخدام مكدسات الخلايا مقابل الألواح اللاصقة التقليدية طريقة أكثر ملاءمة واتساقًا لإنتاج rAAV. تتضمن مكدسات الخلايا معالجة تقنية أقل أثناء تعداء العدوى ، مما يخفف من إزاحة الخلايا المحتملة من الطبقة الأحادية الملتصقة ، مما يسمح بشبكات خلوية أقوى ، وإنتاج أفضل لـ rAAV. بعد تعداء الخلايا ، يكون جمع المادة الطافية وتحلل الخلايا فعالًا ومتسقًا. لحصاد rAAV من الخلايا ، فإن طرق تحلل الخلايا الفيزيائية مثل تجميد الذوبان غير فعالة وغير متسقة حيث لا توجد طريقة لضمان تحلل جميع الخلايا. هنا ، يتم وصف إجراء التحلل الكيميائي. يضمن استخدام محلول التحلل الكيميائي أن تتعرض جميع الخلايا لعامل التحلل بتركيز معين ، بالإضافة إلى مواد مضافة مثل مثبطات الأنزيم البروتيني لمنع تدهور القفيصة. تعمل هذه الطريقة على حل الخلايا بشكل أكثر اتساقًا مما يسمح بحصاد أكثر كفاءة من rAAV. علاوة على ذلك ، فإن تكوير وإزالة الحطام الخلوي يزيل الملوثات المحتملة من المحللة الخام ، والتي يمكن أن تزيد من وقت وتكلفة الترشيح قبل التنقية.

                            على الرغم من أن rAAV قد يكون موجودًا بكميات كبيرة في المحللة الخام ، إلا أن عملية التقاط وتنظيف rAAV يمكن أن تختلف بين طرق التنقية المختلفة ، مثل تدرجات كلوريد السيزيوم. هنا ، يوفر استخدام التنقية اللوني لتقارب الهيبارين سيفروز طريقة سريعة وسهلة لتنقية ناقلات الأمراض التي تؤدي إلى فيروس عالي النقاوة ولا تتطلب تنبذًا فائقًا متدرجًا. ومع ذلك ، لا تحتوي جميع الأنماط المصلية لـ AAV على مجالات ربط الهيبارين ، لذلك لن تكون طريقة التنقية هذه مناسبة لتلك الأنماط المصلية. على سبيل المثال ، بينما يربط AAV2 و AAV6 كبريتات الهيبارين ، فإن AAV4 و AAV5 لا يربط بينهما 30. على الرغم من أن هذه الطريقة ليست عالمية ، إلا أنها فعالة وسهلة لتلك الكبسولات التي تربط كبريتات الهيبارين. على عكس تدرجات الطرد المركزي الفائقة مثل iodixanol ، فإن جميع جسيمات rAAV مرتبطة بغشاء العمود حتى يتم التخلص منها باستخدام عمليات غسل بتركيز ملح عالي ، وتجنب المشكلات مثل خلط التدرجات والمهارة اللازمة لاستعادة الكسور من التدرج. يسمح الشطف من خلال عمليات الغسل ذات تركيز الملح العالي بالتحكم والدقة في شطف الفيروس إلى أجزاء يمكن تركيزها بشكل أكبر. فقط تركيز أجزاء معينة من الفيروس المزال يزيل المزيد من الملوثات المحتملة أثناء التعافي & gt 97٪ من الفيروس المزال. يتمثل أحد قيود تنقية كروماتوغرافيا التقارب الهيبارين سيفروز في أنه لا يميز بين الجسيمات الفارغة والممتلئة. يجب دمج خطوات تنبذ فائق تحليلية إضافية لإزالة الكبسولات الفارغة 31.

                            qPCR هي طريقة فعالة من حيث التكلفة وسريعة لتحديد عدد الجينومات المتجهة في ناقل AAV. على الرغم من أن qPCR هي طريقة قياس كمية حساسة ، إلا أنها لا توفر أي معلومات حول عدد الجسيمات المعدية في الإعداد. علاوة على ذلك ، يمكن أن تؤدي حساسية هذا الاختبار إلى التباين حيث يمكن أن تؤدي الأخطاء الفنية أثناء الماصات إلى تقلب المقايسة البينية. وبالتالي ، بالنسبة لأي تجربة تتضمن مقارنة نواقل مختلفة من AAV ، فمن الأهمية بمكان أن يتم معايرة المتجهات على نفس لوحة qPCR. على الرغم من هذه القيود ، فإن qPCR هي الطريقة الأكثر دقة التي تم تطويرها لمعايرة AAV وهي حاليًا الطريقة الأكثر استخدامًا والمقبولة على نطاق واسع لتقدير متجهات AAV 32. يعتمد استخدام التمهيدي / المسبار الذي يرتبط بـ SV40 polyA لجينوم rAAV على حقيقة أن هذا التسلسل محفوظ عبر العديد من بلازميدات جينوم AAV المصممة في المختبر. إلى جانب اختيار تسلسل محفوظ بين بلازميدات جينوم rAAV للقارئ ، يمكن تصميم تحقيقات qPCR لجميع أجزاء جينوم rAAV ، بما في ذلك ، على سبيل المثال لا الحصر ، المحفزات أو الجينات المحورة أو عوامل ما بعد النسخ.

                            يعد تقييم نقاء وجودة منتج AAV خطوة مهمة في عملية الإنتاج. يمكن استخدام النشاف الغربي للكشف عن البروتينات الهيكلية VP1 و VP2 و VP3 التي تشكل قفيصة AAV ، بالإضافة إلى أي أشكال متغيرة من VP. عادةً ما تكون VP1 و VP2 و VP3 موجودة بنسبة 1: 1: 10 ، ولكن هذا يمكن أن يختلف من 1: 1: 5 إلى 1: 1: 20 اعتمادًا على النمط المصلي. لذلك ، من الأهمية بمكان تحديد النسبة لكل نظام تجريبيًا ، خاصةً لأن المنطقة الطرفية N في VP1 قد ثبت أنها مهمة للعدوى والتحول 33. SDS-PAGE إلى جانب تلطيخ Coomassie هي طريقة مباشرة لاكتشاف VP1 و VP2 و VP3 ، بالإضافة إلى ملوثات بروتين الخلية المضيفة. يوفر استخدام بقع البروتين الفلورية مثل SYPRO Ruby كشف حساسية أعلى لملوثات بروتين الخلية المضيفة مقارنةً بـ Coomassie ، ومع ذلك ، لا تتمتع جميع المعامل بإمكانية الوصول إلى معدات التصوير المطلوبة لتصور الجل. أخيرًا ، يمكن استخدام ELISAs التجاري لتحديد ملوثات بروتين الخلية المضيفة في نواقل AAV المنتجة في خلايا HEK293.

                            يوفر هذا البروتوكول نظرة عامة متعمقة لإنتاج rAAV عيار عالي النقاء للأنماط المصلية التي ترتبط بالهيبارين. في قسم النتائج التمثيلية ، يُظهر استخدام AAV6.2FF الجديد الذي يعبر عن hIgG في مجموعة متنوعة من النماذج الحيوانية سلامة وكفاءة هذا rAAV في الجسم الحي. على الرغم من أن ناقل AAV6.2FF تم إعطاؤه IM ، إلا أنه يمكن إدارة هذه الفيروسات عالية الجودة والنقاء عبر مجموعة متنوعة من الطرق المختلفة في الجسم الحي، مثل الملوثات الالتهابية المحتملة ، مثل بروتين الخلية المضيفة ، تم القضاء عليها من خلال عمليات التنقية لدينا.

                            الاشتراك المطلوبة. يرجى التوصية بـ JoVE لأمين المكتبة الخاص بك.

                            الإفصاحات

                            سارة ك. ووتون مخترعة حاصلة على براءة اختراع أمريكية US10806802B2 لكبسيد AAV6.2FF.

                            شكر وتقدير

                            حصل كل من أميرة دي رغي وبرينا إيه واي ستيفنز وسيلفيا بي توماس وجاكوب جي إي ييتس على رواتب طلاب كلية الطب البيطري في أونتاريو بالإضافة إلى منح أونتاريو للخريجين. حصلت أميرة د. رغي على منحة Mitacs Accelerate. تم تمويل هذا العمل من خلال منحة مشروع المعاهد الكندية للبحوث الصحية (CIHR) (# 66009) ومنحة مشاريع البحوث الصحية التعاونية (شراكة NSERC) (# 433339) إلى SKW.


                            انبعاثات ثاني أكسيد الكربون (طن من ثاني أكسيد الكربون) السكان 2012  الانبعاثات للفرد  الصين 8،782،000،000 1،359،750،000    الولايات المتحدة 5،144،000،000 316،597،000  الهند 2،185،000،000 1،233،460،000 روسيا 1،646،000،000

                            قامت مجموعة من العلماء بدراسة تأثير مادة كيميائية في سلالات مختلفة من البكتيريا. بدأت السلالة A بـ 6000 خلية وانخفضت بمعدل ثابت قدره 2000 خلية في الساعة بعد تطبيق المادة الكيميائية. بدأت السلالة B بـ 2000 خلية وانخفضت


                            الفيروسات الحالة للأورام كمنصات هندسية للعلاج المناعي المركب

                            للبناء بشكل فعال على النجاحات الأخيرة للحصار المناعي ، والعلاج بالخلايا التائية بالتبني ولقاحات السرطان ، من الأهمية بمكان تصميم استراتيجيات تجميعية بشكل عقلاني من شأنها زيادة الفعالية وتوسيع نطاقها لتشمل نسبة أكبر من المرضى. على سبيل المثال ، يؤدي الجمع بين مستضد 4 (CTLA4) والمضاد للبروتين 1 (PD1) لمضاد الخلايا اللمفاوية التائية السامة للخلايا إلى مضاعفة معدل الاستجابة في بعض المرضى المصابين بسرطان الجلد النقيلي. ومع ذلك ، نظرًا لعدم تجانس السرطان ، يبدو من المحتمل أنه قد تكون هناك حاجة إلى مجموعات أكثر تعقيدًا من العوامل المعدلة للمناعة للحصول على استجابات علاجية متسقة ودائمة ضد مجموعة واسعة من السرطانات. هذا يحمل آثارًا خطيرة من حيث السمية للمرضى ، والجدوى لمقدمي الرعاية وتكاليف أنظمة الرعاية الصحية. يتم تقديم حل مقنع عن طريق الفيروسات الحالة للأورام (OVs) ، والتي يمكن هندستها لتتضاعف بشكل انتقائي داخل أنسجة الورم وتدميرها مع زيادة المناعة المضادة للأورام في نفس الوقت. في مقال الرأي هذا ، نجادل في أن مستقبل العلاج المناعي سيشمل OVs التي تعمل كمنصات متعددة تعديل المناعة معبرة عن عوامل مثل مثبطات نقطة التفتيش المناعية ، ومستضدات الورم ، والسيتوكينات ، ومشغلات الخلايا التائية. نوضح هذا المفهوم من خلال اتباع التجارب والمحن للخلايا التائية المتفاعلة للورم من البداية الأولية حتى تنفيذ وظيفة المستجيب السام للخلايا في سرير الورم. نسلط الضوء على الفرص التي لا تعد ولا تحصى للمصابين بالسرطان للمساعدة في التغلب على الحواجز الحاسمة في رحلة الخلايا التائية ، مما يؤدي إلى آليات تآزر جديدة في المعركة ضد السرطان.


                            ثلاثة أبعاد

                            ظهرت أيضًا نواقل مؤتلفة بما في ذلك أي واحد أو أكثر من عديد النيوكليوتيدات الموصوفة أعلاه. يمكن استخدام المتجه الموصوف هنا بالاقتران مع واحد أو أكثر من النواقل الأخرى (على سبيل المثال ، 1 ، 2 ، 3 ، أو أكثر من النواقل) الموصوفة هنا كنظام ناقل ، والذي يمكن استخدامه لإنشاء RhAds المعيبة في النسخ المتماثل (rdsRhAds) أو RhAds المختصة بالنسخ المتماثل (rcsRhAds) الموصوفة هنا. وفقًا لذلك ، يتم تمييز أنظمة ناقلات الفيروسات الغدية لكل من الفيروسات الغدية الأربعة عشر (RhAd54-RhAd67) الموصوفة هنا. يمكن استخدام نظام المتجه هذا لتوليد فيروسات غدية معيبة في النسخ المتماثل وفقًا للطرق المعروفة في المجال ، والتي تم تطبيقها لإنشاء دفعات خالية من فيروسات غدية مؤهلة للنسخ استنادًا إلى ، على سبيل المثال ، Ad5 و Ad11 و Ad35 و Ad49 (انظر ، على سبيل المثال ، WO 97/00326، WO 00/70071 WO 02/40665 US Pub. No. 2005/0232900 ، كلها مدرجة هنا كمرجع).

                            يمكن أن تحتوي المتجهات الموصوفة هنا على المنطقة E1 (على سبيل المثال ، تسلسل به هوية تسلسل 90٪ على الأقل لمنطقة E1 المحددة في الجدول 3) لأغراض إنتاج rcsRhAds.

                            يمكن أن تحتوي المتجهات الموصوفة هنا على متواليات RhAd في الطرف الأيسر وشريط التعبير / التحوير. يمكن أن يحل شريط التعبير للناقل محل أو يعطل كل أو جزء من منطقة E1 من الفيروس الغدي. يمكن أن يشتمل شريط التعبير ، على سبيل المثال ، معزز (على سبيل المثال ، محفز CMV ، على سبيل المثال ، محفز CMVlong) الذي يحفز التعبير عن الجينات المحورة ، واختيارياً ، إشارة ارتباط أدين متعدد (على سبيل المثال ، تسلسل نيوكليوتيد غير متجانس يشفر جين مستضد منتج مهم ، على سبيل المثال ، بروتين بكتيري أو فيروسي أو طفيلي أو فطري أو علاجي أو جزء منه). يمكن حذف منطقة E1 (على سبيل المثال ، تسلسل يحتوي على 90٪ على الأقل من هوية التسلسل لمنطقة E1 المحددة في الجدول 3) (إما جزئيًا أو كليًا) أو تعطيلها أو جعلها غير نشطة بسبب طفرة واحدة أو أكثر. يتم تمثيل هذه النواقل ، على سبيل المثال ، في المتجهات الفارغة الموصوفة هنا (انظر ، على سبيل المثال ، الأشكال 8 ، 10 ، 12 ، 13 ، 17 ، 19 ، 20 ، 23 ، 24 ، 27 ، 29 ، 31 ، 33 ، 35 ، 37 ، 39 ، 40 ، و 44 ، التي تصور المتجهات الفارغة المقابلة لأرقام تعريف التسلسل: 224 ، 226 ، 228 ، 229 ، 234 ، 236 ، 237 ، 240 ، 241 ، 244 ، 246 ، 248 ، 250 ، 252 ، 254 ، 256 و 257 و 262 ، والتي تفتقر إلى المنطقة E1 لكل من RhAd54-RhAd67).

                            يمكن أن تحتوي المتجهات الموصوفة هنا على الجزء الأيسر من متواليات RhAd (على سبيل المثال ، الجزء الأيسر من أي واحد من RhAd54-RhAd67) ، والذي يتضمن قاعدة penton ومناطق تشفير 52K من RhAd ، و / أو الجزء الأيمن من RhAd متواليات (على سبيل المثال ، الجزء الأيمن من أي واحد من جينوم RhAd54-RhAd67 من تقريبًا pVII إلى ITR الأيمن (rITR)). يمكن أن تحتوي المتجهات الموصوفة هنا على الجزء الأيسر من متواليات RhAd (على سبيل المثال ، الجزء الأيسر من أي واحد من RhAd54-RhAd67) ، والذي يتضمن مناطق تشفير pIX و pIVa2 من RhAd ، و / أو الجزء الأيمن من متواليات RhAd (على سبيل المثال ، الجزء الأيمن من أي جينوم RhAd54-RhAd67 من تقريبًا pIX إلى rITR).

                            قد تحتوي المتجهات الموصوفة هنا على منطقة E3 (dE3) محذوفة أو معطلة أو متحولة (على سبيل المثال ، تسلسل له هوية تسلسل 90٪ على الأقل لمنطقة E3 المحددة في الجدول 3) و / أو منطقة E4 (dE4) (على سبيل المثال ، a تسلسل له هوية تسلسل بنسبة 90 ٪ على الأقل لمنطقة E4 المحددة في الجدول 3) ، وهو غير مطلوب لتكرار وتعبئة جسيم الفيروس الغدي. على سبيل المثال ، قد يتم حذف كل أو جزء من منطقة E3 و / أو E4. يتم تمثيل هذه النواقل ، على سبيل المثال ، في نواقل pWe / RhAd.pIX-rITR الموصوفة هنا (انظر ، على سبيل المثال ، الأشكال 9 ، 11 ، 13-16 ، 18 ، 21 ، 22 ، 25 ، 26 ، 28 ، 30 ، 32 ، 34 ، 36 ، 38 ، 41-43 ، و 45 ، والتي تصور المتجهات المقابلة لأرقام تعريف التسلسل: 225 ، 227 ، 230-233 234 ، 235 ، 238 ، 239 ، 242 ، 243 ، 245 ، 247 ، 249 ، 251 ، 253 و 255 و 258-261 و 263 ، والتي تفتقر إلى منطقة E3 لكل من RhAd54-RhAd67).

                            يُفضل حذف المنطقة E3 بشكل عام إذا تم دمج متواليات الجينات المحورة الكبيرة (على سبيل المثال ، تسلسل الحمض النووي الذي يشفر متعدد البيبتيد غير المتجانسة (على سبيل المثال ، مستضد من عامل معدي أو سرطان) ، كما هو موصوف هنا) في المتجه منذ الجينوم الحجم الذي يمكن تعبئته في جسيم وظيفي محدود بحوالي 105٪ من حجم النوع البري. يجب أن يكون مفهوما أنه يمكن إدخال تعديلات أخرى في جينوم الفيروس الغدي ، مثل حذف منطقة E2A.

                            يمكن للخلية المنقولة بواسطة ناقل موصوف هنا أن تكمل أوجه القصور هذه من خلال تقديم وظائف المنطقة (المناطق) المفقودة. يمكن توفير منطقة E2A ، على سبيل المثال ، من خلال متحولة E2A حساسة لدرجة الحرارة ، أو عن طريق توصيل وظائف E4. تشمل الخلايا التي يمكن استخدامها لاستكمال نقص جين غدي (على سبيل المثال ، حذف E1 و / E3 و / أو E4) لناقل موصوف هنا ، على سبيل المثال ، 293 خلية أو خلايا مكملة أخرى لـ E1.

                            يمكن تشكيل نواقل الفيروس الغداني Rhesus الخاصة بالاختراع بكفاءة عند إجراء عدوى متجه لتركيبات ناقل الإعلان في خط خلية مكمل E1 الحالي والذي يعبر بشكل أكبر عن البروتين 55 كيلو (على سبيل المثال ، البروتين 55 كيلو من النمط المصلي البشري 5 و 35 ، النمط المصلي الإعلان ريسوس 52 (انظر ، على سبيل المثال ، GenBank Accession No. AIY35078) و 59 ، أو أنماط مصلية إعلانية أخرى معروفة). يمكن توفير 55 كيلو للخلايا لصنع النواقل الفيروسية المزعومة عبر التعبير المشترك في الخلايا (على سبيل المثال ، عن طريق تعداء مشترك في الخلايا أو عن طريق تكامل الخلية المضيفة). يعزز التعبير المشترك لـ 55 كيلو من إعادة التركيب الفعال للحمض النووي وبالتالي تكوين الفيروس المؤتلف على خطوط الخلايا المكملة لـ E1 الحالية.

                            يحتوي بروتين RhAd52 55k على التسلسل التالي:

                            العديد من أنظمة التعبير النواقل الفيروسية معروفة في الفن وتعديلات جينومات الفيروس الغدي تقع ضمن نطاق الاختراع الحالي ، والذي يرتبط ، بشكل أساسي ، بـ 14 RhAds الموصوفة هنا (RhAd54-RhAd67) متوالياتها الجينية ، أو أجزاء منها ، المتغيرات منها واستخدامها. كما هو موضح أعلاه ، يمكن استخدام أي ناقل واحد موصوف هنا بالاقتران مع واحد أو أكثر من النواقل الأخرى الموصوفة هنا. في بعض النماذج ، يتم استخدام النواقل التي تقوم بتشفير كلا الجانبين الأيسر والأيمن من جينوم RhAd من أجل توليد عامل RhAd محدد موصوف هنا.

                            ظهرت أيضًا نواقل لتوليد فيروسات غدية خيمرية تتضمن جزءًا من واحد أو أكثر من RhAd54-RhAd67genomes ، بالإضافة إلى جزء من جينوم واحد أو أكثر من الفيروسات الأخرى. قد تشمل ناقلات الفيروس الغدي الوهمي استبدال كل أو جزء من ، على سبيل المثال ، هيكسون و / أو بروتين ليفي من RhAd54-RhAd67. على سبيل المثال ، قد يتم استبدال جزء أو كل بروتين هيكسون من RhAd54-RhAd67 بفيروس آخر (على سبيل المثال ، واحد أو أكثر من مناطق متغيرة البروتين هيكسون (HVRs) من RhAd54-RhAd67 (على سبيل المثال ، HVR محدد في الجدول 2 من بروتين هيكسون من أي واحد من RhAd54-RhAd67).

                            قد يتم استبدال جزء أو كل بروتين الألياف في RhAd54-RhAd67 بجزء من فيروس آخر. على سبيل المثال ، يمكن استبدال مجال مقبض الألياف لـ RhAd54-RhAd67. يمكن استبدال المناطق المستبدلة بمنطقة مشتقة من فيروسات غدية ذات معدل انتشار مصلي أقل مقارنة بتلك الموجودة في Ad5 ، مثل المجموعة الفرعية B (Ad11 ، Ad34 ، Ad35 ، Ad50) والمجموعة الفرعية D (Ad15 ، Ad24 ، Ad26 ، Ad48 ، و Ad49) فيروسات غدية ، وكذلك فيروسات غدية قردية (على سبيل المثال ، Pan9 ، المعروف أيضًا باسم AdC68). يمكن أيضًا استخدام العمود الفقري المتجه للفيروسات الغدانية لـ Ad5 ، Ad11 ، Ad15 ، Ad24 ، Ad26 ، Ad34 ، Ad48 ، Ad49 ، Ad50 ، أو Pan9 / AdC68 لتحضير ناقل يتضمن استبدال كل أو جزء من واحد أو أكثر من فوق HVRs hexon من RhAd54-RhAd67.


                            معلومات اكثر

                            سياسة أمان الإنترنت

                            باستخدام هذا الموقع ، فإنك توافق على المراقبة الأمنية والتدقيق. لأغراض أمنية ، ولضمان بقاء الخدمة العامة متاحة للمستخدمين ، يستخدم نظام الكمبيوتر الحكومي هذا برامج لمراقبة حركة مرور الشبكة لتحديد المحاولات غير المصرح بها لتحميل المعلومات أو تغييرها أو التسبب بأي ضرر ، بما في ذلك محاولات رفض الخدمة للمستخدمين.

                            المحاولات غير المصرح بها لتحميل المعلومات و / أو تغيير المعلومات على أي جزء من هذا الموقع محظورة تمامًا وتخضع للمقاضاة بموجب قانون الاحتيال وإساءة استخدام الكمبيوتر لعام 1986 وقانون حماية البنية التحتية للمعلومات الوطنية لعام 1996 (انظر العنوان 18 USC §§ 1001 و 1030).

                            لضمان أداء موقع الويب الخاص بنا بشكل جيد لجميع المستخدمين ، تراقب لجنة الأوراق المالية والبورصات (SEC) وتيرة الطلبات الخاصة بمحتوى SEC.gov لضمان عدم تأثير عمليات البحث الآلية على قدرة الآخرين على الوصول إلى محتوى SEC.gov. نحتفظ بالحق في حظر عناوين IP التي ترسل طلبات زائدة. تحدد الإرشادات الحالية المستخدمين إلى ما لا يزيد عن 10 طلبات في الثانية ، بغض النظر عن عدد الأجهزة المستخدمة لإرسال الطلبات.

                            إذا أرسل المستخدم أو التطبيق أكثر من 10 طلبات في الثانية ، فقد تكون الطلبات الإضافية من عنوان (عناوين) IP محدودة لفترة وجيزة. بمجرد انخفاض معدل الطلبات إلى ما دون الحد الأدنى لمدة 10 دقائق ، يمكن للمستخدم استئناف الوصول إلى المحتوى على SEC.gov. تم تصميم ممارسة SEC هذه للحد من عمليات البحث الآلي المفرطة على SEC.gov وليس المقصود أو المتوقع أن تؤثر على الأفراد الذين يتصفحون موقع SEC.gov على الويب.

                            لاحظ أن هذه السياسة قد تتغير عندما تدير هيئة الأوراق المالية والبورصات SEC.gov لضمان أن الموقع يعمل بكفاءة ويظل متاحًا لجميع المستخدمين.

                            ملحوظة: لا نقدم دعمًا تقنيًا لتطوير أو تصحيح عمليات التنزيل المبرمجة.