معلومة

كيف يمكن أن تؤدي طفرة الفيروسات إلى فقدان ملاءمتها للأجسام المضادة دون فقدان ملاءمة مستضد الخلايا التي تصيبها؟

كيف يمكن أن تؤدي طفرة الفيروسات إلى فقدان ملاءمتها للأجسام المضادة دون فقدان ملاءمة مستضد الخلايا التي تصيبها؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

من المعروف أن الفيروسات تتحور ، وبالتالي تهرب من الخلايا المناعية وتتفادى التطعيم. بالنظر إلى أن هناك خاصية واحدة ونفس الخصوصية للمفتاح لكل من المستقبل على الخلية المصابة المسببة للمرض بعد دخول الخلية وكذلك للأجسام المضادة أو مستقبلات الخلايا المناعية للخلايا المناعية ، فكيف يمكن أن يكون هذا الفيروس قد تحور وبالتالي الهروب من الدفاع لا يزال قادرًا على الاتصال بخلايا الجسم؟

يجب أن يكون مفتاحًا واحدًا ونفس القفل. نظرًا لأنه هو نفس المفتاح ، يبدو من المنطقي أن كل من الأقفال - الأجسام المضادة والمستضدات متطابقة ، لأنها تتناسب مع نفس المفتاح. إذا أدت الطفرة إلى "عدم اللياقة" فيما يتعلق بالجسم المضاد ، فكيف يمكن أن يظل المفتاح مناسبًا للجسم؟

في سياق الطفرات والتلقيح ، قد يتم الرد على هذا السؤال بشكل بديهي من خلال "حواتم مختلفة".

هل هناك رأي في ذلك إطلاقا؟ يبدو أن الكتب المدرسية ليست صريحة على الإطلاق. هل هو تافه جدا سؤال؟ هل يوجد حاتمتان للفيروسات: أحدهما للأجسام المضادة والآخر لخلية الجسم؟ الطفرة بطريقة ما تحصر نفسها عمدا في السابق؟

تمت إضافة خط فكري واحد: إذا كنت تفكر في بعض الحاتمة المشتركة (المتقاطعة) ، فهي طفرة واحدة ونفس الطفرة تؤثر على كلا الجانبين ، والالتصاق بالجسم المضاد ، بالإضافة إلى الالتصاق بالمستقبل المستهدف. منطقيا ، من الممكن أن يكون هناك طفرة واحدة ناجحة في كلا الطرفين ، أي ينتج عنها فقدان ملاءمة الجسم المضاد وتحسين الالتصاق بالخلية المستهدفة في نفس الوقت. ولكن بعد ذلك ، لتوضيح سؤالي ، إنها مسألة احتمالية - كما هو الحال في جانب الجسم المضاد ، فإن فقدان اللياقة هو الذي يجب أن يكون - في نفس الوقت - مكسبًا في جانب الالتصاق بالمستقبل. حدسيًا ، هذا غير مرجح إلى حد كبير ، مع حاتمة مشتركة.

ما سبق يتحدث عن حواتم مختلفة وغير مشتركة واستراتيجية متعددة الخطوات في تطور الفيروس. هل من الممكن وهل هناك أي سلطة على افتراض أنه من بين تلك الحيوانات المستنسخة الفيروسية التي لا تفقد تقاربها مع الأجسام المضادة وتبقى تحت الهجوم (حيث أن فقدان الجسم المضاد المناسب ، انظر أعلاه ، يعني فقدان ملاءمة الهدف ، في الاحتمال) أن الاختيار يتطلب المكان: أولئك الذين لا يتحورون بعيدًا عن هجوم الأجسام المضادة يطورون تقارب المستقبل ، ويصبحون "أفضل قليلاً" ، في السرعة ، ويحققون ميزة في الاستهداف ضد الأجسام المضادة التي يتم اكتشافها. قد يفسر هذا ويكون متماسكًا مع CoV-2 مما يجعل المظهر ليس كمتغير لـ CoV الذي لن تصل إليه الأجسام المضادة بعد الآن ، ولكن أكثر من ذلك بكثير باعتباره متغيرًا أدى إلى تحسين تقارب الخلية المستهدفة.

لذلك ، بافتراض أن الطفرات ذات الصلة التي يتم اختيارها من بين تلك السلالات التي تظل في متناول الأجسام المضادة الموجودة ولا تتغير بعيدًا عن حاتمة جانب الجسم المضاد ستكون متسقة مع النتائج التي تفيد بأن اللقاحات الحالية والأجسام المضادة التي تحفزها تظل صالحة ضد سلالات جديدة وقادمة من فيروس كورونا. -19. إذا تم اكتشاف أن السلالات الجديدة أكثر مسببة للأمراض ، فسيكون ذلك متماسكًا مع هذا الافتراض أيضًا.

من أجل فهم أفضل ، قارن هذا المقطع من الإجابة جيبين: "... التي تفقد لياقتها ضد الجهاز المناعي ، لكنها تخضع لتعديل جيني مع فيروسات مماثلة وتصبح معدية مرة أخرى." "فقدان اللياقة ضد جهاز المناعة" بالمعنى الدقيق للكلمات يعني اكتساب ملاءمة الجسم المضاد - ومع ذلك ، يتحدث المؤلف عن "أن تصبح معديًا" ، وبالتالي يشير إلى الخلايا المستهدفة. جعلني هذا أعيد التفكير في ما سبق على النحو التالي:

إذا كنت لا تفترض وجود أي حاتمة مشتركة متطابقة لخلية الجسم (فقدان اللياقة للأجسام المضادة يعني اكتساب اللياقة ضد الجهاز المناعي ، ولكن في نفس الوقت فقدان اللياقة ضد الخلايا المستهدفة التي تحدد المرض) هناك بعض النجاح "في الخروج "مدى وصول الجسم المضاد الذي يعني" النجاح "ونفس الشيء" الخروج "من عالم حاتمة الخلية المستهدفة مما يعني" الفشل "، وفقدان العدوى. في كلا الجانبين ، يكون الأمر مجرد "في الجانب السلبي" ، فقدان النوبة (ومع ذلك ، فإن النجاح والفشل منفصلان للغاية). على المرء أن يعترف بأن كلا الجانبين له معنى: مجرد فقدان التوافق مع الجسم المضاد هو النجاح (حاتمة مستقبلات الجسم تظل دون تغيير). لنجاح الفيروس على جانب خلية الجسم ، ومع ذلك ، لن تكون هناك خسارة ، يجب أن يكون هناك مكسب مناسب لمستقبل آخر في خلية الجسم. لماذا إذن ، لتوضيح سؤالي أكثر ، يجب أن يفضل الإجهاد الانتقائي اتخاذ الطريق الصعب: اكتساب وظيفة تجاه خلية الجسم ، وعدم "الانهيار" بسهولة من ملاءمة الجسم المضاد ، وبالتالي يصبح مناسبًا ضد جهاز المناعة؟

باختصار ، يبدو أن هناك إجابتين بديلتين ممكنتين: أ. هناك نوعان من الحلقات المنفصلة. يهرب الفيروس من نوبة الجسم المضاد وهذا يكفي ب. هناك بالفعل حاتمة مشتركة ومشتركة: لا يكفي "الانسحاب" والخروج من تناسب الجسم المضاد ولكن الطفرة نفسها - حيث أن البداية هي وجود حاتمة مشتركة لا منفصلة - يجب أن تجد توافقًا جديدًا مستقبلات خلايا الجسم.

تظهر إجابة ثالثة ، بالنسبة لي: الحلقات منفصلة ، وليست مشتركة ، والطفرة هي عملية متعددة الخطوات. ثم أولاً ، ومن المثير للاهتمام ، يجب أن تأتي الطفرة إلى نوبة جديدة على جانب الخلية المستهدفة من الجسم أولاً ، لأن هذا التسلسل فقط - وليس العكس - هو الذي يحمل ضغطًا انتقائيًا للهروب من جهاز المناعة في الطفرة الثانية التالية.


على المرء أن يميز السبب والنتيجة: الفيروسات الوحيدة التي تنجو من الانتقاء الطبيعي هي تلك التي يمكنها التهرب من الدفاعات المناعية بينما تصيب الخلايا بشكل فعال. سلالة الفيروس التي لم تنجح في أي من هاتين المهمتين هي أقل ملاءمة ومن المحتمل أن تنقرض.

يمكن للمرء أن يطرح سؤالاً حول التعديلات التي تم إجراؤها على بروتينات الفيروس والتي تسمح له بأن يكون محددًا للغاية فيما يتعلق (لا) يرتبط به. ومع ذلك ، فإن الإجابة ستعتمد بالضرورة على الفيروس / السلالة المحددة والظروف المحددة (والتي قد تعني الظروف الوبائية خلال وقت انتشارها ، أو اللقاحات الموجودة ، أو حتى المريض المحدد).

من الضروري أيضًا الإشارة إلى هذا البيان من المعروف أن الفيروسات تتحور ، وبالتالي تهرب من الخلايا المناعية وتتفادى التطعيم. ليس صحيحًا بشكل عام ، ولكنه يقدم فقط استراتيجية تطورية واحدة ممكنة لبقاء الفيروس ، والتي تتميز بتكوين عدوى مزمنة. المثال النموذجي هنا هو فيروس نقص المناعة البشرية. إلى حد ما ، يمكن للمرء أيضًا استخدام هذا الوصف للفيروسات الشبيهة بالإنفلونزا ، والتي تفقد لياقتها ضد جهاز المناعة ، ولكنها تخضع لتعديل جيني مع فيروسات مماثلة وتصبح معدية مرة أخرى. ومع ذلك ، يمكن للمرء أن يجادل في أن هذه ليست طفرة ، ولكنها فيروس جديد.

تشمل الاستراتيجيات الأخرى التي تستخدمها الفيروسات للبقاء (ينظر إليها من وجهة نظر علم الوراثة السكانية بدلاً من علم الفيروسات):

  • اضرب واهرب نهج ، سمة من سمات الفيروسات الشبيهة بالبرد ، والتي تنجح في التكاثر قبل إثارة استجابة الجهاز المناعي التكيفي ، وبالتالي تكون قادرة على إعادة إصابة نفس المضيفين.
  • التعايش، سمة من سمات الفيروسات الشبيهة بالهربس ، والتي تتجنب الانقراض من خلال كونها منخفضة المستوى نسبيًا ، أي عدم إثارة استجابة مناعية كبيرة ، أثناء إنشاء عدوى دائمة (على سبيل المثال ، من خلال الاندماج في الحمض النووي للمضيف).
  • تداول دائم - الحالة الأكثر شهرة هي الجدري ، الذي استمر في الوجود بين البشر لآلاف السنين بمجرد التنقل في جميع أنحاء العالم. لم يستلزم ذلك أي تكيف ، ولهذا كان من الممكن أن ينقرض هذا الفيروس عن طريق التطعيم.
  • لا استراتيجية - تعد أوبئة الإيبولا في البشر طريقًا مسدودًا تطوريًا ، حيث إن الفيروس الذي يقتل جميع مضيفيه تقريبًا لا بد أن ينقرض. سبب استمرار تفشي فيروس إيبولا هو أن هذا الفيروس يُظهر مرضًا غير ضار نسبيًا ، تشبه الانفلونزا، والسلوك في بعض الحيوانات وأحيانًا يسقط على البشر. إن الاختلاف بينك وبين الجدري هو في الغالب اختلاف كمي: فالإيبولا تقتل ضحاياه بسرعة كبيرة ، بحيث لا تنتشر بكفاءة.

مراجع
فلينت وآخرون ، مبادئ علم الفيروسات


سأتناول هذا السؤال وأتجاهل بقية المنشورات / النظريات (الطويلة جدًا):

بالنظر إلى أن هناك خاصية واحدة ونفس الخصوصية للمفتاح لكل من المستقبل على الخلية المصابة المسببة للمرض بعد دخول الخلية وكذلك للأجسام المضادة أو مستقبلات الخلايا المناعية للخلايا المناعية ، فكيف يمكن أن يكون هذا الفيروس قد تحور وبالتالي الهروب من الدفاع لا يزال قادرًا على الاتصال بخلايا الجسم؟

نظرًا لأنه هو نفس المفتاح ، يبدو من المنطقي أن كل من الأقفال - الأجسام المضادة والمستضدات متطابقة ، لأنها تتناسب مع نفس المفتاح. إذا أدت الطفرة إلى "عدم اللياقة" فيما يتعلق بالجسم المضاد ، فكيف يمكن أن يظل المفتاح مناسبًا للجسم؟

هذا الافتراض خاطئ من عدة جوانب.

أولاً ، التقارب ليس اقتراحًا ثنائيًا (نعم / لا). من الناحية الفنية ، فإن ما يهم ارتباط الفيروس بالمستقبل هو الشغف ، وهو التأثير المركب للصلات في نقاط متعددة في البروتين ، لكن العديد من الأوراق البحثية في علم الفيروسات تستخدم المصطلح السابق عند الحديث عن الفيروسات المرتبطة بالمستقبلات.

ربما يمكنك أن ترى بالفعل أن العديد من "الحلول" أو "المفاتيح" (وبالتالي) ممكنة بالفعل لنفس "القفل". على سبيل المثال ، فإن SARS-CoV و SARS-CoV-2 RBD (مجالات ربط المستقبلات) متشابهة بنسبة 73٪ فقط ، على الرغم من أن كلا الفيروسين يرتبطان بمستقبلات ACE2 في البشر ، "بشكل كافٍ" للإصابة (وفي النهاية تتكاثر).

علاوة على ذلك ، فإن استعارة "القفل والمفتاح" ليست سوى تقريب فظ للآلية الأكثر تعقيدًا للدخول الفيروسي. ولكن لتمييز جانب واحد من ذلك ، يمكن "للمفتاح" بشكل أساسي "تغيير الشكل" (يخضع لتغيير توافقي) بحيث "يبدو مختلفًا" أثناء الدخول الفيروسي عما قد ينظر إليه بخلاف ذلك على الأجسام المضادة ، على سبيل المثال

يمكن أن يكون RBD في فيروسات كورونا إما في حالة الوقوف ، مما يتيح ربط المستقبلات ، أو حالة الاستلقاء ، والتي لا ترتبط بمستقبلات المضيف. أظهرت دراسات Cryo-EM أنه في حالة ارتفاع فيروس السارس ، يكون RBD في الغالب في حالة الوقوف ؛ ومع ذلك ، في ارتفاع SARS-CoV-2 ، يكون RBD في الغالب في حالة الاستلقاء. لذلك ، مقارنةً بـ SARS-CoV ، على الرغم من أن SARS-CoV-2 RBD لديه تقارب أعلى لربط hACE2 ، إلا أنه يصعب الوصول إليه ، مما يؤدي إلى تقارب ربط hACE2 مماثل أو أقل لارتفاع SARS-CoV-2. للحفاظ على معدل العدوى المرتفع مع الحفاظ على سهولة الوصول إلى RBD ، يعتمد SARS-CoV-2 على تنشيط البروتياز الإستراتيجي الثاني. [...] تنشيط البروتياز لارتفاعات الفيروس التاجي يحتمل أن يؤدي إلى التغيير الهيكلي النهائي للفيروس التاجي S2 اللازم لدمج الغشاء. هذه العملية لا رجعة فيها وتحتاج إلى تنظيم صارم.

كما تمت مناقشته لاحقًا في تلك الورقة ، فإن إخفاء / حماية RBD هو في الواقع شائع إلى حد ما في العديد من أنواع الفيروسات الأخرى (HIV ، Hepatis C ، Ebola ، إلخ.)

كنقطة مثيرة للاهتمام هنا توضح كيف يمكن أن ينخفض ​​التقارب ولكن يمكن أن تزداد الشغف (ربما جنبًا إلى جنب مع الانجراف المستضدي) ، وجدت ورقة بحثية عام 2017 عن H3N2 ما يلي:

أشارت التقارير الأخيرة إلى أن فيروسات H3N2 البشرية الحالية لم تعد تتمتع بخصوصية صارمة تجاه المستقبلات من النوع البشري [باستخدام اختبارات التراص الدموي النموذجية]. باستخدام مصفوفة ميكروأري جليكان لمستقبلات الإنفلونزا مع جليكانات مجرى الهواء الممتدة ، وجدنا أن فيروسات H3N2 قد حافظت في الواقع على خصوصية النوع البشري ، لكنها طورت تفضيلًا لمجموعة فرعية من المستقبلات التي تشتمل على جليكانات متفرعة مع بولي-إن-أسيتيل-لاكتوزامين ممتد (بولي- N-acetyl-lactosamine). سلاسل LacNAc) ، وهي خصوصية مشتركة مع جائحة H1N1 (Cal / 04) Hemagglutinin لعام 2009. [...] ومن اللافت للنظر أن هذه المستقبلات من النوع البشري ذات الفروع الطويلة لديها القدرة على زيادة الشهوة من خلال الارتباط في وقت واحد بوحدتين فرعيتين من قاطع هيماجلوتينين واحد.

كغذاء نهائي على الرغم من مدى ملاءمة تشبيه قفل المفتاح ، لا يبدو أن فيروسات الجدري تستخدم أي مستقبل معين للارتباط بالخلايا ، فهي قادرة على الارتباط بالجليكوزامينوجليكان (GAGs) ، الموجودة في جميع الأغشية حقيقية النواة ، على الرغم من اختلاف الخلايا المختلفة في درجة كبريتات GAGs الخاصة بها ، والتي بدورها تغير تقاربها مع فيروسات الجدري.


السبب الثاني الذي يجعل فرضيتك خاطئة ، فإن الأجسام المضادة ليست مجرد نسخ من المستقبلات الموجودة على الخلايا الفعلية التي قد يدخلها الفيروس. تحتاج الأجسام المضادة إلى "حل" مشكلة أبسط من إدخال خلية الفيروس ؛ على وجه التحديد ، فإن الجسم المضاد (إذا قصرنا المناقشة على أولئك الذين يستهدفون مجال ربط المستقبلات) يحتاج فقط إلى "إفساد" RBD بطريقة ما ، وبالتالي فإن الأخير لا "يتناسب" مع مستقبل الخلية بعد الآن. على سبيل المثال ، هذان الجسمان المضادان ضد السارس كلاهما يديران هذا الاضطراب ، على الرغم من أن أحدهما يرتبط فقط بجانب RBD:


ثالثًا ، هناك بالفعل عملية تطور سريع للأجسام المضادة تُعرف باسم نضج تقارب الأجسام المضادة:

ينشأ التنوع المتسلسل الشامل لجزيئات الجسم المضاد من عدة مصادر: (1) التنويع التوافقي ، حيث مجموعتان من المقاطع الجينية المتسلسلة الخفيفة (L) ، VL و JL ، وثلاث مجموعات من المقاطع الجينية المتسلسلة الثقيلة (H) ، VH ، D ، و JH ، إعادة الترتيب لإنتاج مناطق متغيرة وظيفية (V) ؛ (2) الانضمام غير الدقيق لهذه الأجزاء الجينية ؛ و (3) فرط الطفرات الجسدية ، حيث يتم إدخال طفرات النقطة ، وكذلك عمليات الإدراج والحذف (indels) ، عبر التسلسلات التي تشفر سلاسل L و H. تكون الخلايا البائية التي تعبر عن الأجسام المضادة ذات الألفة المحسنة مجهزة بشكل أفضل للتنافس على المستضد وبالتالي استقبال الإشارات التي تؤدي إلى التوسع التفضيلي وتنويع تسلسل الأجسام المضادة عبر جولات إضافية من فرط الطفرة الجسدية. من خلال هذه العملية التطورية السريعة للطفرة والاختيار ، يتحسن تقارب الجسم المضاد عادةً من 10 إلى 5000 ضعف أثناء الاستجابة المناعية ، مما يعزز دفاع المضيف.

إذا كان المضيف محظوظًا ، فقد ينتج أجسامًا مضادة تعمل ضد فيروسات متعددة. على سبيل المثال هناك مثال معروف لجسم مضاد من مريض Covid-19 والذي يعمل أيضًا على تحييد السارس الأصلي ، على الرغم من أن هذا المريض ليس لديه تاريخ من الإصابة بالفيروس الأخير / الأقدم. يُعرف هذا أساسًا باسم التفاعل المتبادل للأجسام المضادة. ومع ذلك ، لاحظ أن هذا الجسم المضاد ليس فعالًا بشكل متساوٍ ضد كلا الفيروسين ، فهو يحتاج إلى تركيز أعلى لتحقيق نفس التأثير ضد SARS-CoV مقارنةً بـ SARS-CoV-2.

تم عزل الجسم المضاد COVA1-16 مؤخرًا من فرد يتعافى من COVID-19 وقام بتحييد SARS-CoV-2 (تركيز مثبط نصف الحد الأقصى [IC50] ، 0.13 ميكروغرام / مل) و SARS-CoV (IC50 ، 2.5 ميكروغرام / مل) الفيروس الكاذب.


ما هو FIP؟

مقالات مقترحة

التهاب الصفاق المعدي السنوري (FIP) هو مرض فيروسي يصيب القطط بسبب سلالات معينة من فيروس يسمى فيروس كورونا السنوري. توجد معظم سلالات فيروس كورونا في الجهاز الهضمي ولا تسبب مرضًا خطيرًا. يشار إلى هذه باسم الفيروس التاجي المعوي القطط (FeCV). عادةً لا تظهر القطط المصابة بـ FeCV أي أعراض أثناء العدوى الفيروسية الأولية ، ولكنها قد تعاني أحيانًا من نوبات قصيرة من الإسهال و / أو علامات خفيفة على الجهاز التنفسي العلوي تتعافى منها تلقائيًا. عادةً ما تصنع القطط المصابة بـ FeCV استجابة مناعية يتم من خلالها إنتاج الأجسام المضادة للفيروس في غضون 7-10 أيام من الإصابة. في ما يقرب من 10 في المائة من القطط المصابة بـ FeCV ، يمكن لطفرة واحدة أو أكثر من الفيروس تغيير سلوكه البيولوجي ، مما يؤدي إلى إصابة خلايا الدم البيضاء بالفيروس ونشره في جميع أنحاء جسم القط. عند حدوث ذلك ، يشار إلى الفيروس باسم FIPV. يحدث تفاعل التهابي شديد مع FIPV حول الأوعية في الأنسجة حيث توجد هذه الخلايا المصابة ، غالبًا في البطن أو الكلى أو الدماغ. هذا التفاعل بين الجهاز المناعي للجسم والفيروس هو المسؤول عن تطوير FIP. بمجرد أن تتطور القطة إلى FIP السريري ، يكون المرض عادةً تقدميًا ودائمًا ما يكون مميتًا بدون علاج أصبح متاحًا مؤخرًا ، ولكن لم تتم الموافقة عليه بعد لعلاج FIP في القطط من قبل إدارة الغذاء والدواء (FDA) (انظر أدناه). على حد علمنا ، لا يمكن أن تنتقل فيروسات كورونا من القطط المصابة إلى البشر.

هل قطتي معرضة لخطر تطوير FIP؟

من المحتمل أن تكون أي قطة تحمل FeCV معرضة لخطر الإصابة بـ FIP ، ولكن القطط الأصغر سنًا معرضة بشكل أكبر لخطر الإصابة بـ FIP ، مع ما يقرب من 70 ٪ من الحالات التي تم تشخيصها في القطط التي يقل عمرها عن سنة ونصف و 50 ٪ من الحالات تحدث في القطط أقل من 7 أشهر من العمر. يُعتقد أن أكثر طرق انتقال فيروس FeCV شيوعًا تحدث عندما تنقل الملكات المصابة الفيروس إلى قططهن الصغيرة ، عادةً عندما يكون عمر القطط ما بين خمسة وثمانية أسابيع من العمر. يبدو أن القطط الموجودة في مرافق عالية الكثافة (مثل الملاجئ والبطاريات) أكثر عرضة لتطور FIP ، مثل القطط النقية المرباة والقطط الذكور والقطط المسنة ، لأسباب لا تزال غير واضحة.

ما هي أعراض FIP؟

القطط التي تعرضت في البداية لـ FeCV عادة لا تظهر عليها أعراض واضحة. قد تظهر على بعض القطط أعراض خفيفة في الجهاز التنفسي العلوي مثل العطس ودموع العيون وإفرازات الأنف ، بينما قد يعاني البعض الآخر من علامات معدية معوية خفيفة مثل الإسهال. في معظم الحالات ، تكون هذه العلامات الخفيفة محدودة من تلقاء نفسها. فقط نسبة صغيرة من القطط التي تتعرض لـ FeCV تتطور إلى FIP ، ويمكن أن يحدث هذا أسابيع أو شهور أو حتى سنوات بعد التعرض الأولي لـ FeCV.

هناك نوعان رئيسيان من FIP ، شكل انسيابي أو "رطب" وشكل غير مؤثر أو "جاف". بغض النظر عن الشكل الذي يتطورون فيه في نهاية المطاف ، فإن القطط المصابة بـ FIPV عادةً ما تظهر أولاً علامات غير محددة للمرض مثل فقدان الشهية وفقدان الوزن والاكتئاب والحمى. من المهم أيضًا ملاحظة أن حالات الشكل الانسيابي لـ FIP يمكن أن تتطور إلى الشكل غير الانسيابي والعكس صحيح.

بشكل عام ، تتطور علامات الشكل اللاإرادي ، والتي قد تشمل العلامات غير المحددة المذكورة أعلاه بالإضافة إلى العلامات العصبية بما في ذلك النوبات والرنح (حركات غير طبيعية أو غير منسقة) بشكل أبطأ من تلك الخاصة بالشكل الانسيابي.

عادة ما تتطور علامات الشكل الانسيابي لـ FIP وتتقدم بسرعة نسبيًا وتشمل تطور العلامات غير المحددة المذكورة أعلاه جنبًا إلى جنب مع تراكم السوائل في تجاويف الجسم ، بما في ذلك البطن والصدر (تجويف الصدر). قد تتطور القطط المصابة إلى شكل بطن بسبب تراكم السوائل في البطن ، وإذا كان تراكم السوائل مفرطًا ، فقد يصعب على القطة التنفس بشكل طبيعي.

هل يمكن اختبار قطتي من أجل FIP؟

لسوء الحظ ، لا يوجد حاليًا اختبار نهائي لتشخيص FIP. بينما يمكن قياس مستويات الأجسام المضادة ، أو التتر ، لفيروس كورونا ، إلا أنها لا تستطيع التمييز بشكل قاطع بين التعرض لـ FeCV و FIPV. تعني النتيجة الإيجابية فقط أن القطة تعرضت مسبقًا لفيروس كورونا ، ولكن ليس بالضرورة لـ FIPV. على الرغم من هذا القيد ، إلا أن القطط الصغيرة التي تعاني من حمى لا تستجيب للمضادات الحيوية والتي تحتوي على نسبة عالية من الفيروسات التاجية غالبًا ما يتم تشخيصها على أنها FIP (بشكل مناسب في معظم الحالات).هذا صحيح بشكل خاص إذا بدأ السائل المميز (لون أصفر مع نسبة عالية من البروتين وتركيز خلايا الدم البيضاء) يتراكم داخل تجاويف الجسم. ومع ذلك ، فإن القطة السليمة ذات العيار المرتفع للفيروس التاجي (أي العديد من الأجسام المضادة ضد فيروس كورونا) ، ليس بالضرورة أكثر عرضة لتطوير FIP أو أن تكون حاملة لـ FIPV من قطة ذات عيار منخفض. في القطط التي تعاني من ضعف في جهاز المناعة ، قد لا تسبب عدوى FIPV ارتفاع التتر بسبب فيروس كورونا بسبب عدم قدرة الجهاز المناعي على إنتاج أجسام مضادة كافية ضد الفيروس.

يمكن للاختبارات الأخرى المتاحة ، من الناحية النظرية ، الكشف عن وجود الفيروس نفسه. يمكن أن يكتشف أحد هذه الاختبارات ، المسمى اختبار immunoperoxidase ، البروتينات الفيروسية في خلايا الدم البيضاء المصابة بالفيروس في الأنسجة ، لكن خزعة الأنسجة المصابة ضرورية للتقييم. وهناك نوع آخر ، يسمى اختبار التألق المناعي ، يمكنه اكتشاف البروتينات الفيروسية في خلايا الدم البيضاء المصابة بالفيروس في الأنسجة أو سوائل الجسم. في الآونة الأخيرة ، تم استخدام تقنية تسمى تفاعل البلمرة المتسلسل (PCR) للكشف عن المادة الوراثية الفيروسية في الأنسجة أو سوائل الجسم. على الرغم من أن هذه الاختبارات يمكن أن تكون مفيدة ، إلا أن أيا منها لا يكون دقيقًا بنسبة 100٪ ، ويعاني كل منها من قيودها الخاصة التي قد تؤدي إلى نتائج سلبية خاطئة أو إيجابية خاطئة.

هل يمكن علاج FIP؟

حتى وقت قريب ، كان FIP يعتبر مرضًا غير قابل للعلاج. بينما لا تزال هناك بعض أوجه عدم اليقين فيما يتعلق بالفعالية طويلة المدى للأدوية المضادة للفيروسات التي تم تحديدها مؤخرًا لعلاج FIP (والأهم فيما يتعلق بفعاليتها في علاج الشكل غير الانسيابي لـ FIP) ، فإن الدراسات في كل من المختبر والقطط المملوكة للعميل مع يقترح FIP الذي يحدث بشكل طبيعي أن الدواء المشار إليه حاليًا باسم GS-441524 قد يثبت في النهاية أنه خيار علاجي فعال (الحد الأدنى) للشكل الانسيابي لـ FIP. في حين أن بعض حالات الشكل غير الانسيابي لـ FIP استجابت للعلاج GS-441524 في هذه التجارب ، فإن الاستجابات في الحالات مع هذا الشكل من FIP لم تكن مواتية مثل تلك التي شوهدت في حالات الشكل الانسيابي. هذا الدواء غير معتمد حاليًا من قِبل إدارة الأغذية والعقاقير (FDA) ، وعلى الرغم من وجود عدد من المصادر التي تعرضه للبيع ، تشير التقارير القصصية إلى أن المنتجات التي تقدمها بعض هذه المصادر تختلف اختلافًا كبيرًا في كل من دقة تركيز الدواء المبلغ عنه ونقاوته. من المهم جدًا مناقشة المخاطر والفوائد والمسائل التنظيمية والاستحواذ المتطورة مع طبيبك البيطري إذا كنت تفكر في العلاج باستخدام GS-441524. يشار أيضًا إلى الرعاية الداعمة ، بما في ذلك علاج السوائل وتصريف السوائل المتراكمة ونقل الدم ، في بعض الحالات.

هل يمكنني حماية قطتي من الحصول على FIP؟

الطريقة الوحيدة لمنع FIP بشكل نهائي في القطط هي منع عدوى FeCV ، والتي يمكن أن تكون صعبة نظرًا لطبيعتها في كل مكان. هذا صحيح بشكل خاص للقطط التي تعيش في كثافة عالية (ملاجئ ، بطاريات) ، ويوصى بإسكان القطط بكثافة عند أو أقل من ثلاثة في الغرفة لتقليل الضغوط التي يمكن أن ترتبط بظروف المعيشة المزدحمة. من المهم ملاحظة أنه في حين أن FeCV معدي تمامًا (يتم تمريره في براز ولعاب القطط المصابة ويصيب القطط الأخرى بشكل أساسي عبر تجويف الفم) ، لا يُعتقد أن FIPV كذلك. بدلاً من ذلك ، يتطور FIP في القطط الفردية بعد إصابتها بـ FeCV ويخضع الفيروس لطفرات ليصبح FIPV (لا يتم تمرير FIPV نفسه في البراز). إن الحفاظ على صحة القطط قدر الإمكان ، بما في ذلك منع الإصابة بالفيروسات الأخرى مثل فيروس ابيضاض الدم لدى القطط وفيروس الكاليسيف بالتلقيح المناسب ، عند الحاجة ، من المرجح أن يقلل من احتمالية الإصابة بـ FIP. يجب أن تبقى صناديق القمامة نظيفة وبعيدة عن أطباق الطعام والماء. اقترحت بعض المصادر أن القطط المكتسبة حديثًا وأي قطط يشتبه في إصابتها بـ FeCV يجب فصلها عن القطط الأخرى ، على الرغم من أن فائدة استراتيجية الإدارة هذه قابلة للنقاش.

يوجد لقاح واحد فقط مرخص من FIP ، ولكن هذا اللقاح له فعالية مشكوك فيها في منع FIP ، ولا يوصى به بشكل روتيني من قبل اللجنة الاستشارية للقاح السنوري التابع للجمعية الأمريكية لممارسي القطط. يبدو أن اللقاح آمن ، لكن يجب موازنة مخاطر وفوائد التطعيم بعناية. يجب على مالكي القطط استشارة الطبيب البيطري لمساعدتهم على تحديد ما إذا كان يجب تحصين قطتهم.


الملخص

إن مجال ربط مستقبلات البروتين الشائك (RBD) لـ SARS-CoV-2 هو الهدف الجزيئي للعديد من اللقاحات والوقاية القائمة على الأجسام المضادة والتي تهدف إلى السيطرة على COVID-19. يثير مثل هذا التركيز الجزيئي الضيق شبح التهرب المناعي الفيروسي كأسلوب فشل محتمل لهذه التدخلات الطبية الحيوية. مع ظهور سلالات جديدة من SARS-CoV-2 مع إمكانية الانتقال المتغيرة والتهرب المناعي ، فإن السؤال الحاسم هو: ما مدى سهولة هروب الفيروس من الأجسام المضادة المعادلة (nAbs) التي تستهدف ارتفاع RBD؟ للإجابة على هذا السؤال ، قمنا بدمج تحليل وظيفة بنية RBD مع إطار النمذجة التطورية. كشف تحليلنا للهيكل والوظيفة أن حواتم nAbs التي تستهدف RBD تتداخل مع بعضها البعض بشكل كبير ويمكن تجنبها من خلال المسوخ الهروب مع تقاربات ACE2 المماثلة للنوع البري ، والتي يتم ملاحظتها في بيانات المراقبة التسلسلية وتصيب الخلايا في المختبر. يشير هذا إلى أن تكلفة لياقة طفرات تجنب nAb منخفضة. ثم استخدمنا النمذجة التطورية للتنبؤ بتواتر الهروب المناعي قبل وبعد الانتشار الواسع لـ nAbs بسبب اللقاحات أو التحصين السلبي أو المناعة الطبيعية. تشير النمذجة الخاصة بنا إلى أن طفرات SARS-CoV-2 مع واحدة أو اثنتين من الطفرات الضارة بشكل طفيف من المتوقع أن توجد بأعداد كبيرة بسبب الاختلاف الجيني المحايد ، وبالتالي يمكن أن تتطور مقاومة اللقاحات أو العلاجات الوقائية الأخرى التي تعتمد على واحد أو اثنين من الأجسام المضادة للحماية بسرعة. - وبشكل متكرر- في ظل الاختيار الإيجابي. يمكن مقارنة الجداول الزمنية للمقاومة المتوقعة مع تلك الخاصة بحركية الاضمحلال لـ nAbs التي تم رفعها ضد المستضدات التطعيمية أو الطبيعية ، مما يثير آلية محتملة ثانية لفقدان المناعة لدى السكان. لذلك يجب أن تكون استراتيجيات القضاء على الفيروس متنوعة عبر الأهداف الجزيئية والطرق العلاجية.

الاقتباس: Van Egeren D و Novokhodko A و Stoddard M و Tran U و Zetter B و Rogers M et al. (2021) خطر الهروب التطوري السريع من التدخلات الطبية الحيوية التي تستهدف بروتين ارتفاع SARS-CoV-2. بلوس وان 16 (4): e0250780. https://doi.org/10.1371/journal.pone.0250780

محرر: محمود نجيب ، جامعة أوبسالا ، السويد

تم الاستلام: 9 فبراير 2021 وافقت: 14 أبريل 2021 نشرت: 28 أبريل 2021

حقوق النشر: © 2021 Van Egeren et al. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ في أي وسيط ، بشرط ذكر المؤلف والمصدر الأصليين.

توافر البيانات: جميع البيانات ذات الصلة موجودة داخل الورقة وملفات المعلومات الداعمة الخاصة بها.

التمويل: د. يسلم بتمويل من NSF-Simons Center for Mathematical and Statistical Analysis of Biology في Harvard ، رقم الجائزة # 1764269 ، ومبادرة Harvard Quantitative Biology. يقر A.N. بتمويل من برنامج زمالة أبحاث الخريجين التابع لمؤسسة العلوم الوطنية بموجب المنحة رقم DGE-1762114. أي آراء ونتائج واستنتاجات أو توصيات معبر عنها في هذه المادة هي آراء المؤلف (المؤلفين) ولا تعكس بالضرورة آراء المؤسسة الوطنية للعلوم. لم يكن للممولين دور في تصميم الدراسة أو جمع البيانات وتحليلها أو اتخاذ قرار النشر أو إعداد المخطوطة. قدمت شركة Fractal Therapeutics الدعم في شكل رواتب للمؤلفين A. تم توضيح الأدوار المحددة لهؤلاء المؤلفين في قسم "مساهمات المؤلفين".

تضارب المصالح: لقد قرأت سياسة المجلة وكان مؤلفو هذه المخطوطة لديهم الاهتمامات المتنافسة التالية: A. هم موظفون ومساهمون في شركة Fractal Therapeutics. D.V.E. ، A.N. ، B.Z. ، و D.J.- M. هم مساهمون في Fractal Therapeutics. هذا لا يغير التزامنا بسياسات PLOS ONE بشأن مشاركة البيانات والمواد.


أصول المرض

الصورة: wildpixel / iStock / Getty Images Plus

هذا المقال جزء من كلية الطب بجامعة هارفارد تغطية مستمرة الطب والبحوث الطبية الحيوية والتعليم الطبي والسياسة المتعلقة بوباء SARS-CoV-2 ومرض COVID-19.

منذ بداية الجائحة ، أصبحت المصطلحات العلمية الباطنية لغة شائعة - بروتين سبايك ، PCR ، مرنا.

التسبب في المرض ليس من بينها. ومع ذلك ، عندما يتعلق الأمر بفهم COVID-19 ، فقد تكون هذه هي الكلمة الأكثر أهمية التي لم تشق طريقها بعد إلى المعجم السائد.

التسبب في المرض - أو "أصل المرض" - هو دراسة العمليات التي تؤدي إلى الخلل الوظيفي الفسيولوجي والمرض. في حالة COVID-19 ، إنها دراسة الأذى الناجم عن الفيروس - كيف يتفاعل SARS-CoV-2 مع الخلايا والأنسجة والأعضاء المختلفة للتسبب في COVID-19.

مع تقدم العالم في رحلته عبر هذا الوباء المتطور باستمرار ، فإن فهم "كيف" COVID-19 يمكن أن يكون السؤال الأكثر أهمية على الإطلاق.

السؤال قد حفز البحث جاليت ألتر و ديفيد كنيب خلال العام الماضي. شارك الاثنان في قيادة مجموعة أبحاث مسببات الأمراض في اتحاد ماساتشوستس حول جاهزية مسببات الأمراض (MassCPR) ، وهو جهد بحثي دولي متعدد المؤسسات ومتعدد التخصصات تم إنشاؤه في 2 مارس 2020 في كلية الطب بجامعة هارفارد للمساعدة في مكافحة الوباء الحالي و تمهيد الطريق لمحاربة المستقبل.

ألتر أستاذ الطب في HMS ومحقق في معهد راغون في MGH و MIT وهارفارد. نايب أستاذ علم الأحياء الدقيقة وعلم الوراثة الجزيئي في معهد بلافاتنيك في HMS.

بعد عام من إعلان منظمة الصحة العالمية أن COVID-19 جائحة عالمي ، ناقش Alter and Knipe ما تعلموه عن التفاعل الذي يغذي المرض بين SARS-CoV-2 ومضيفه البشري وجهودهم المستمرة لفهم المشهد المتغير لـ كوفيد -19.

يقود جاليت ألتر وديفيد كنيب ، (في الصورة هنا في ووهان في نوفمبر 2019) ، مجموعة مسببات المرض في MassCPR

ثالوث المرض

يشمل الثالوث النموذجي للأمراض المعدية مضيفًا وممرضًا والتفاعل بين الاثنين. لفهم آليات العدوى ، لا يمكن دراسة العائل البشري ولا العامل الممرض بشكل منفصل - فالمرض هو دائمًا وظيفة للتفاعل بين الاثنين.

  • الممرض - بنية وسلوك الفيروس وكيف يتطور بمرور الوقت تحت ضغوط مختلفة من حوله.
  • المضيف تحدد العوامل الفردية الأساسية - الجينات ، والاختلافات في الاستجابة المناعية ، والصحة العامة ، والعمر - كيف ولماذا قد يؤثر الفيروس على شخص بشكل مختلف عن الآخر لإحداث مجموعة من مظاهر المرض.

أظهر COVID-19 تنوعًا مذهلاً ليس فقط في نطاق شدته - من بدون أعراض إلى مميت - ولكن أيضًا في مجموعة الأعضاء وأنظمة الأعضاء التي يمكن أن يؤثر عليها.

  • التفاعل- المضيف والممرض ينخرطون في معركة مستمرة. المجال الذي تتكشف فيه هذه المعركة هو جهاز المناعة. تعدل الاستجابة المناعية للمضيف بقوة سلوك الفيروس مرة واحدة داخل الجسم ، وحجم العدوى ، وشدة المرض ، وخطر تلف الأعضاء والمضاعفات.

ومع ذلك ، فإن فهم COVID-19 ، أو أي مرض معقد لهذه المسألة ، ليس معادلة بسيطة لتلخيص الأجزاء الفردية. يحمل كل من المتغيرات الثلاثة مجاهيل متعددة داخل نفسه. بطريقة ما ، فإن فهم الآلية المرضية لـ COVID-19 يشبه حل مشكلة ثلاثية الأجسام ، وهو تحد سيء السمعة في الميكانيكا الكلاسيكية.

قال كنيب: "إن دراسة التسبب في المرض هي في الأساس حل أحجية". "إنه نهج نظم لدراسة مرض ما ، لذا فإن أحد أدوار مجموعتنا هو تجميع أجزاء المعرفة من مجالات الدراسة لشرح النظام."

يؤكد Alter and Knipe على أن الفهم الشامل للإمراض COVID-19 يجب أن يتجاوز كيفية تصرف الفيروس داخل المضيف البشري. قد يكون هذا الرأي الكلاسيكي مقيدًا. يشير Alter إلى أن تفاعل المضيف مع الممرض ليس سوى حلقة واحدة في سلسلة طويلة من الأحداث البيولوجية.

"نحاول طرح كل سؤال حول هذا الفيروس - كيف يصيب ، وكيف يسبب المرض ، وكيف يؤثر على العالم من حولنا ، ولكن أيضًا كيف يعيش الفيروس في الطبيعة حتى نتمكن من الاستعداد للفيروس التاجي التالي" ، ألتر قالت. "نحن نركز على كل شيء يمكن أن يتفاعل معه العامل الممرض ، ما يسمح له بالبقاء والاستمرار ، وهذا نطاق أكبر بكثير للتحقيق."

من المؤكد أن هذا النطاق مذهل ، لكن العلماء قاموا أيضًا بتوليد معرفة هائلة حول فيروس بشري جديد تمامًا يسبب مرضًا بشريًا جديدًا تمامًا ، وقد فعلوا ذلك بوتيرة لم تتحقق من قبل في تاريخ العلم والطب.

لقد حددت هذه المعرفة المتزايدة ملامح المرض وملأت العديد من الفراغات الحرجة. فيما يلي بعض الأفكار الرئيسية التي استخلصها الباحثون من مجموعة عمل مسببات الأمراض في MassCPR.

العامل الممرض: بقاء الأذكى

تم توضيح بنية SARS-CoV-2 في وقت مبكر من الوباء ، وتم وضع تسلسل جينوم الفيروس ونشره في أوائل يناير 2020 - بعد أسابيع فقط من صدور التقارير الأولى من ووهان ، الصين.

لقد شكل سلوك الممرض تحديًا أكبر. كانت إحدى النقاط العمياء الحرجة في وقت مبكر من الوباء هي انتقال الفيروس بدون أعراض وقبل الأعراض ، مما شكل عقبة كبيرة في وقف انتشار الفيروس.

من المشاكل السلوكية الأخرى لـ SARS-CoV-2 مدى سرعة تغيره. توقع الباحثون أن الفيروس سوف يتحور. كانوا يعلمون أن متغيرات جديدة من SARS-CoV-2 ستظهر في النهاية. ما أذهلهم هو مدى قدرة بعض الطفرات الفيروسية على تفادي دفاعات الأجسام المضادة.

كانت الملاحظة المحيرة الأخرى هي أن بعض الطفرات ظهرت في أجزاء نائية جغرافيًا من العالم. أدرك الباحثون أن الفيروس كان يطور علاجات تطورية طبيعية ضد دفاعات المناعة للمضيف.

في الأشهر الأولى من الوباء ، كان الافتراض - والأمل - هو أن SARS-CoV-2 لن يتغير بسرعة كبيرة لأنه ، على عكس معظم فيروسات الحمض النووي الريبي ، لديه بروتين "تصحيح التجارب المطبعية" وظيفته منع الكثير تغييرات في الجينوم الفيروسي.

لكن الفيروس تغير بالفعل ، ويخشى الباحثون من أنه إذا ظل إطلاق اللقاح بطيئًا ، فإن التغييرات الفيروسية قد تفوق قدرتنا على مواكبة تلك التغيرات.

اعرف عدوك

الميكروب له هدف واحد فقط - البقاء والتكاثر. لتحقيق ذلك ، يجب أن يتغير الفيروس استجابةً لبيئته. تحدث هذه التغييرات التكيفية من خلال الطفرة. تعتبر الطفرات جزءًا طبيعيًا من دورة حياة الفيروس وتحدث في كل مرة يصنع فيها الفيروس نسخًا منه.

بعض الطفرات ليس لها أي عواقب ، والبعض الآخر يمكن أن يؤذي الفيروس نفسه ، والبعض الآخر يمكن أن يصبح مفيدًا للميكروب ، مما يسمح له بالانتشار بسهولة أكبر من مضيف إلى آخر أو لتفادي الدفاعات المناعية للمضيف. إذا أعطت الطفرة ميزة تطورية للفيروس ، فيمكن لهذا البديل الأنسب أن يتفوق تدريجياً على الآخرين ويصبح هو السائد.

على المستوى الأساسي ، للبقاء على قيد الحياة على المدى الطويل ، يجب على أي كائن حي أن يشارك في عملية توازن دقيقة بين حماية جينومه ضد العديد من الطفرات وإدخال طفرات تكيفية جديدة تجعله أكثر تكيفًا للبقاء على قيد الحياة في بيئته.

قال كنيب: "لقد كانت قصة التطور الفيروسي بأكملها محيرة". "اعتقدنا في البداية أن الفيروس كان مستقرًا جينيًا ، لكن المتغيرات مع نفس التغييرات المتعددة ظهرت في العديد من المناطق الجغرافية. هذا ليس تطورًا تدريجيًا ".

بدلاً من ذلك ، أضاف كنيب ، تشير الدراسات الحديثة إلى أن إعادة التركيب الفيروسي - أو خلط أجزاء من الحمض النووي الريبي الفيروسي - قد يؤدي إلى توليفات جينية جديدة أكثر عدوى من الطفرات.

في حالة SARS-CoV-2 ، تظهر معظم الطفرات ببساطة كنتيجة للتكيف مع مضيف جديد. تشير أفضل الأدلة الحالية إلى أن SARS-CoV-2 شق طريقه إلى البشر من الخفافيش ، وهو انتقال يجبر الفيروس على التحسن بشكل أفضل في غزو خلايا مضيفه الجديد.

يبدو أن الطفرات الأخرى لـ SARS-CoV-2 تظهر استجابة للضغط من الجهاز المناعي للمضيف. ولضمان بقائه داخل المضيف البشري ، يأتي الفيروس بحلول بديلة ـ الهروب من الطفرات ـ التي تسمح له بمراوغة الدفاعات المناعية.

الدفاع المناعي الأكثر شيوعًا والأفضل فهمًا هو تحييد الأجسام المضادة ، وهي بروتينات مناعية تمنع الفيروس من دخول الخلايا وإصابتها. لمنع SARS-CoV-2 من دخول الخلايا البشرية ، تلتصق الأجسام المضادة بمنطقة من الفيروس تسمى مجال ربط المستقبلات (RBD). قد يفرض المنطق أن الفيروس سيطور أولاً طفرات تمكنه من الهروب في هذا الجزء الضعيف من بنيته ، ولكن ، لدهشة الباحثين ، تظهر الطفرات الآن على أجزاء أخرى من الفيروس أيضًا.

قال كنيب: "الفيروس لا يتغير فقط حيث تهاجم الأجسام المضادة". "إنه يتغير في جميع أنحاء الجينوم. لماذا يتغير كثيرًا على طول الطريق؟ "

السؤال هو أيضا دليل.

تثير هذه الملاحظة فرضية مثيرة للاهتمام. وتشير إلى أن الفيروس قد يتعرض لضغط مناعي في مكان آخر على جينومه وأن هذا الضغط لا ينشأ عن استجابة الجسم المضاد. وقال كنيب إن هذا يشير إلى أن الأجسام المضادة ليست هي القوات الوحيدة التي ينشرها جهاز المناعة لدينا لتعطيل العدو.

يشير ظهور المتغيرات الفيروسية التي تبدو أكثر قابلية للانتقال إلى قدرة الفيروس على التغيير بسرعة استجابة للضغط المناعي. وهذا بدوره يسلط الضوء على أهمية تحصين قطاعات كبيرة من السكان ، وبالتالي تقليل عدد المضيفين للفيروس للإصابة وعدد فرص التحور.

قال كنيب إن فهم السلوك الفيروسي يتطلب مراقبة جينية عدوانية لـ SARS-CoV-2 ، ولكن بنفس القدر من الأهمية ، البحث في كيفية تكاثر الفيروسات التاجية بشكل عام والفيروسات الأخرى. وأضاف أن المعلومات المستمدة من دراسة السلوك الفيروسي يمكن أن تساعد العلماء على تخمين التحركات التالية للممرض ، مثل ظهور طفرات جديدة ، وعاملها في تصميم العلاجات واللقاحات واسعة النطاق التي تستهدف مواقع متعددة من الضعف على الفيروس.

خطوط الدفاع

تقليديا ، أولى العلماء الذين يدرسون الأمراض المعدية اهتمامًا أكبر للعوامل الممرضة من المضيف. لكن COVID-19 ، ربما أكثر من الأمراض المعدية الأخرى ، أشار إلى أهمية العوامل الخاصة بالمضيف.

قال ألتر: "المدهش حقًا في هذه العدوى بالتحديد هو المعركة المجنونة بين المضيف ومسببات الأمراض". "إنه لأمر رائع أن نرى كيف يمكن للاستجابة المناعية أن تستحوذ على هذا الفيروس."

بشكل عام ، ينشأ دفاعنا ضد الميكروبات من فرعين من جهاز المناعة.تشتمل المناعة الفطرية على آليات وقائية مختلفة نولد بها. المناعة التكيفية أو المكتسبة هي شكل من أشكال التعليم المستمر لجهاز المناعة. عندما يواجه مسببات الأمراض الجديدة ، يتعلم كيفية التعامل معها.

بمجرد أن يلتقي الجهاز المناعي بالعوامل الممرضة ، يجب أن يتعرف عليه باعتباره أجنبيًا ويحتفظ بذكرياته. عند المواجهات اللاحقة ، تتعرف دفاعاتنا المناعية على العامل الممرض باعتباره عدوًا مألوفًا ويقيم دفاعًا سريعًا ، مما يؤدي غالبًا إلى ظهور أعراض قليلة أو عدم ظهور أعراض على الإطلاق.

بشكل عام ، تستخدم المناعة التكيفية شكلين من أشكال الدفاع: الأجسام المضادة ، ما يسمى بالمناعة الخلطية ، والخلايا التائية ، المعروفة أيضًا باسم المناعة الخلوية.

لم يتم توضيح دور الأنواع المختلفة من المناعة في COVID-19 بشكل كامل. من بين الذراعين ، كانت المناعة التكيفية هي المحور الرئيسي للجهود البحثية.

هل الجرعة تصنع السم؟

كيف يستجيب الجهاز المناعي مبكرًا أثناء الإصابة يمكن أن يساعد العلماء على التنبؤ بمسار المرض والبقاء على قيد الحياة. يعد البحث عن أدلة منبهة - أو مؤشرات حيوية - للتنبؤ بمن سيصاب بمرض حاد ومن لن يصاب به أحد التحديات الأساسية في الوقت الحالي.

أحد المؤشرات المباشرة إلى حد ما لشدة المرض هو كمية الفيروس المنتشر في الدم ، أو الحمل الفيروسي. قارن البحث الذي أجراه عضو MassCPR جوناثان لي الأحمال الفيروسية وشدة المرض بين الأشخاص المصابين الذين تم نقلهم إلى المستشفى بسبب مرض خطير أو يعانون من مرض خفيف وتعافوا في المنزل.

بالمقارنة مع الأشخاص الذين يعانون من مرض خفيف ، فإن أولئك الذين يعانون من مرض خطير بدرجة كافية تتطلب دخول المستشفى ليس لديهم فقط حمولات فيروسية أكبر ولكن أيضًا زيادة علامات الالتهاب وأمراض الجهاز التنفسي الأسوأ وتراجع في خلايا الدم البيضاء المقاومة للعدوى. يميل الأشخاص ذوو الأحمال الفيروسية العالية إلى الإصابة بأمراض أكثر شدة وخطر أكبر للوفاة.

تشير النتائج إلى أن ملامح الحمل الفيروسي يمكن أن تكون تنبئًا مفيدًا لمن قد يمرض بشدة ، ولكن فيما وراء التقسيم الطبقي للمخاطر ، تشير الملاحظات إلى آلية محتملة تكمن وراء مسارات المرض المختلفة.

وتشير إلى أن الأشخاص الذين تعرضوا لجرعة أولية أعلى من الفيروس هم أكثر عرضة للإصابة بأمراض خطيرة وأن أجهزة المناعة لدى هؤلاء الأشخاص قد لا تكون قادرة على التحكم في تكاثر الفيروس وتقليله. نتيجة لذلك ، قد يهرب الفيروس من الرئتين ، ويغزو الدم والبذور في الأعضاء الأخرى ، مما يؤدي إلى انتشار الالتهابات والمرض.

الأجسام المضادة: الجودة تفوق الكمية

الأجسام المضادة ، البروتينات التي يصنعها الجهاز المناعي استجابة لمسببات الأمراض ، هي سمة مميزة لوظيفة المناعة. تقليديا ، يُعتقد أن المستويات الأعلى من الأجسام المضادة ، أو التتر ، تنذر باستجابة مناعية أكثر قوة.

لكن الأدلة الناشئة تشير إلى أنه عندما يتعلق الأمر بالأجسام المضادة في COVID-19 ، فإن دقة الأجسام المضادة ودقتها قد تكون أكثر أهمية من مستويات الأجسام المضادة المنتجة. وجد البحث الذي أجراه ألتر وزملاؤه أن مرضى كوفيد -19 الذين تعافوا والذين استسلموا للمرض أظهروا اختلافات في أنواع الأجسام المضادة التي صنعوها. وأظهرت الدراسة أن الاختلاف الرئيسي هو جزء الفيروس الذي تتغذى عليه الأجسام المضادة.

على سبيل المثال ، كان الأشخاص الذين طوروا أجسامًا مضادة تستهدف في الغالب بروتين السنبلة - التركيب الذي يستخدمه SARS-CoV-2 لدخول الخلايا البشرية - كانوا أكثر عرضة للبقاء على قيد الحياة من الأشخاص الذين طوروا أجسامًا مضادة تستهدف بشكل أساسي جزءًا آخر من الفيروس ، والمعروف باسم nucleocapsid.

بعبارة أخرى ، يقول ألتر ، قد لا يكون إنتاج الأجسام المضادة كافيًا. ما يهم هو ما إذا كانت هذه الأجسام المضادة موطنًا للهدف الصحيح. أظهر البحث أيضًا أن الأجسام المضادة القادرة على "تجنيد" الجهاز المناعي لمحاربة العدوى تطورت بسرعة لدى الأفراد الذين نجوا ، لكن تطورها تضاءل بين أولئك الذين ماتوا في النهاية.

ومع ذلك ، فقد عززت دراسة أخرى منشورة حديثًا بقيادة Alter فكرة أن نوع الأجسام المضادة وليس مجرد مستوياتها قد يكون مهمًا في تكوين ذاكرة مناعية ضد SARS-CoV-2 بعد الإصابة الأولية.

يوضح العمل أنه عندما يتعلق الأمر بجعل الناس محصنين من المواجهات اللاحقة مع SARS-CoV-2 ، فإن الأمر الأكثر أهمية هو ما إذا كان الفرد قد طور مستويات قوية من الأجسام المضادة ضد أجزاء معينة من الفيروس.

تقدم دراسة صغيرة أخرى أجريت على 113 مريضًا بقيادة الباحث في MassCPR ، أليخاندرو بالازس ، ملاحظة مثيرة أيضًا: أن جودة الأجسام المضادة قد تكون أكثر أهمية من كميتها. المرضى الذين أصيبوا بمرض شديد أو ماتوا من COVID-19 لم يكن بالضرورة لديهم عدد أقل من الأجسام المضادة. ومع ذلك ، بدت أجسامهم المضادة أقل لياقة وأقل قدرة على منع الفيروس.

ذكريات من لقاءات الماضي

كان أحد الأسئلة المهمة حول تفاعل المضيف والممرض هو ما إذا كان لدى بعض الأشخاص مناعة جزئية ضد فيروس SARS-CoV-2 من التعرض السابق للفيروسات من نفس العائلة.

يقدم فهم هذه المناعة المتقاطعة تفسيراً واحداً محتملاً وراء الملاحظة التي مفادها أن الأشخاص الذين لديهم سمات مخاطر مماثلة ، مثل العمر أو الظروف الأساسية ، قد يعانون من عدوى SARS-CoV-2 بشكل مختلف: مناعتهم الموجودة مسبقًا تخفف من شدة المرض.

تشير دراسة بقيادة مانيش ساجار وجوزيف ميزجيرد ، أعضاء MassCPR في جامعة بوسطن ، إلى أن الأشخاص الذين تحمل أجهزتهم المناعية علامات العدوى الحديثة بفيروسات كورونا الأخرى - أبناء عمومة أقل ضراوة لـ SARS-CoV-2 - لم يكونوا محميين من SARS-CoV-2 ولكن عند الإصابة به ، يميلون إلى الإصابة بمرض أكثر اعتدالًا.

يمكن أن يساعد فهم الاختلافات في الاستجابة المناعية لفيروسات كورونا المختلفة العلماء على تحديد الخدوش في درع الممرض وبناء علاجات تستهدف مناطق الضعف تلك.

قامت دراسة بقيادة عضو MassCPR وعالم الوراثة في HMS ستيفن إليج برسم خرائط آثار استجابات الأجسام المضادة البشرية ضد سبعة فيروسات كورونا ، بما في ذلك فيروسات البرد الشائعة و SARS-CoV-2.

كشف التحليل عن اختلافات في استجابات الأجسام المضادة للمرضى الذين كانت لديهم نتائج مختلفة ، تتراوح من عدوى خفيفة إلى مرض خطير. تحدد الرؤى النقاط الضعيفة على الفيروس والتي يمكن أن تكون بمثابة أهداف للدفاع المناعي وتوجيه تصميم العلاجات واللقاحات القائمة على الأجسام المضادة.

تشير البيانات إلى أن الاستجابات المناعية التبادلية تمنح بطريقة ما مناعة طبيعية ضد الفيروس الجديد ، وإذا تمكنا من فهم كيفية حدوث ذلك ، فيمكننا التعامل بشكل أفضل مع تصميم لقاحات ضد هذا الفيروس المحدد ، ولكن أيضًا ضد أي فيروس كورونا ينبثق في المستقبل ، قال ألتر.

الدفاعات الخلوية

حتى الآن ، لا يزال دور المناعة الخلوية في عدوى SARS-CoV-2 غير مفهوم جيدًا.

أشارت الأدلة المتزايدة بسرعة على مدى الأشهر العديدة الماضية إلى الدور الحاسم للخلايا التائية في COVID-19. ولكن لا تزال هناك أمور أساسية مجهولة: متى يتم تنشيط الخلايا التائية بعد الإصابة بالعدوى لوقف انتشار الفيروس؟ هل تختلف قوة الاستجابة من فرد لآخر ، وإذا كان الأمر كذلك ، فما هي العوامل التي تكمن وراء هذه الاختلافات؟ هل استجابات الخلايا التائية والأجسام المضادة مرتبطة ببعضها البعض ، وإذا كان الأمر كذلك ، فكيف تعدل بعضها البعض؟ ما هي المدة التي تحتفظ فيها الخلايا التائية بذاكرة SARS-CoV-2؟

الإجابات على هذه الأسئلة لها آثار علاجية. سيكون تصميم العلاجات واللقاحات التي تحفز الأجسام المضادة والاستجابات الخلوية هدفًا مهمًا ، ليس فقط لكبح السارس-CoV-2 ولكن أيضًا للتعامل مع فيروسات كورونا الجديدة التي من المحتمل ظهورها في المستقبل.

قال Knipe and Alter إن مطوري اللقاحات تقليديًا ركزوا على تصميم لقاحات تنظم الأجسام المضادة المعادلة. وأضاف الباحثان أنه مع نمو فهمنا للتفاعل بين الجهاز المناعي وفيروس SARS-CoV-2 ، سيكون من المهم تجاوز تحييد الأجسام المضادة وتصميم لقاحات تحفز أشكالًا أخرى من الدفاع.

وتشمل هذه مناعة الخلايا التائية أو التظلم والبلعمة ، وهي عملية طلاء الميكروبات بالبروتينات اللزجة وتغليفها والتهامها.

قال ألتر: "يصمم المطورون لقاحات مع الحماية القائمة على الأجسام المضادة كهدف نهائي في الاعتبار ، ولكن ما تعلمناه على مر السنين من العديد من اللقاحات المعتمدة إكلينيكيًا هو أنه يمكنهم العمل من خلال آليات أخرى غير معادلة الأجسام المضادة".

قال ألتر وكنيب إن التلميحات حول مثل هذه الآليات كثيرة. على سبيل المثال ، تشير الدلائل إلى وجود مناعة جزئية بعد الجرعة الأولى من لقاحات الرنا المرسال قبل اللقطة التعزيزية الثانية. خلال هذه الفترة القصيرة ، لا توجد أجسام مضادة محايدة في الدم ، ومع ذلك فإن وجود حماية جزئية يشير إلى أن الجهاز المناعي يجد طرقًا أخرى لتوفير الحماية.

قال ألتر: "ما يخبرنا به هذا هو أن هناك لاعبين آخرين ، ليس فقط الأجسام المضادة - الجهاز المناعي الفطري ، والجهاز المناعي التكيفي ، والاستجابة المناعية الخلوية - ويمكن لهذه الدفاعات المختلفة ، بالتصرف معًا ، الاستجابة للفيروس".

الكثير من الشيء الجيد

تتكشف عدوى COVID-19 على مرحلتين: المرحلة الحادة - التي تستمر من 5 إلى 7 أيام في المتوسط ​​- تتميز باختطاف الفيروس للخلايا داخل الجسم والتكاثر السريع.

تتبع هذه المرحلة مرحلة التهابية (اليوم 7-14 يومًا) ، والتي تتميز بتنشيط مسارات إشارات مناعية متعددة تنتج جزيئات التهابية ضد الفيروس وكذلك ضد الخلايا البشرية المصابة بالفيروس.

إذا كانت هذه الاستجابة الوقائية مضللة أو قوية للغاية ، فيمكن أن تلحق أضرارًا جانبية خطيرة بالخلايا والأنسجة والأعضاء. في أقصى حالاته ، يمكن للالتهاب المنحرف أن يطلق العنان لما يسمى بعاصفة السيتوكين التي تغمر الجسم وتدمر الأعضاء وتؤدي في بعض الأحيان إلى الموت.

يتمثل أحد المجالات ذات الاهتمام النشط في رسم خرائط دقيقة للخطوات والتسلسل المتسلسل للوسطاء الالتهابيين الذين يعززون المرض بشكل مباشر أو غير مباشر. يمكن لمثل هذه المعرفة أن تفيد في تصميم علاجات مضادة للالتهابات دقيقة التوجيه تستهدف مسارات محددة.

في الوقت الحالي ، يتم التعامل مع الالتهاب المفرط لـ COVID-19 باستخدام دواء تعديل المناعة في المدرسة القديمة ، وهو ديكساميثازون ، وهو كورتيكوستيرويد يثبط المناعة بشكل عام.

أظهرت الأبحاث أن الدواء يمكن أن يمنع الموت بين المصابين بأمراض الرئة الشديدة الناجمة عن COVID-19. ومع ذلك ، فإن العلاج يحمل المخاطر التقليدية للكورتيكوستيرويدات ، مثل ارتفاع ضغط الدم والكوليسترول وسكر الدم ، ويجب استخدامه بحذر في المرضى الذين يعانون من ضعف في جهاز المناعة لأنه يمكن أن يثبط بشدة قدرتهم على مكافحة العدوى.

يعد تحديد سلسلة الأحداث البيوكيميائية التي تبلغ ذروتها في عاصفة خلوية أمرًا بالغ الأهمية لتصميم علاجات مضبوطة بدقة لا تثبط المناعة الكلية.

تحديد الفترة المناسبة لتوقيت العلاج هو سؤال مطور.

قال كنيب: "التوقيت مهم جدًا لأنه إذا أعطيته في وقت مبكر جدًا ، فسوف تمنع الاستجابة المضادة للفيروسات". "إذا لم تعطيه بسرعة كافية ، فلن تمنع أمراض المناعة أو الاستجابة الالتهابية."

وأضاف كنيب: "هذه هي القضية برمتها التي كنا نكافح معها في التسبب في المرض - مدى تعقيد الاستجابة المناعية للمضيف والضائقة التنفسية الحادة والفيروس". "كيف نتبدل ونضبط العلاج بدقة بحيث نقضي على أمراض المناعة ولكن لا نزال نسمح للاستجابة المناعية للسيطرة على الفيروس."

بالإضافة إلى إلحاق الضرر بالخلايا والأعضاء ، قد يتداخل الالتهاب الحاد مع قدرة الجسم على تكوين ذاكرة مناعية طويلة المدى ، وفقًا لبحث أجراه عضو MassCPR Shiv Pillai. يُظهر عمله أن الأشخاص المصابين بـ COVID-19 الذين يعانون من عواصف السيتوكين قد ينتهي بهم الأمر أيضًا إلى إنتاج عدد أقل من الخلايا البائية المنتجة للأجسام المضادة ، والتي تعتبر بالغة الأهمية في تكوين ذاكرة مناعية مستدامة.

تظهر الدراسة أن جذر الخلل الوظيفي هو السيتوكين المحدد ، TNF ، والذي يبدو أنه يتداخل مع تكوين المراكز الجرثومية - مناطق في الغدد الليمفاوية والطحال حيث تنمو الخلايا البائية المنتجة للأجسام المضادة وتتكاثر. تقدم النتائج تفسيرًا واحدًا محتملاً للمناعة غير الدائمة التي شوهدت في COVID-19.

ما هي مدة الذاكرة المناعية؟

كان اثنان من أكثر الأسئلة أهمية منذ بداية الوباء هما: ما المدة التي يحتفظ بها الجهاز المناعي البشري بذاكرة فيروس SARS-CoV-2؟ هل تختلف الذاكرة المناعية من شخص لآخر ، وإذا كان الأمر كذلك ، فما الذي يدفع هذا الاختلاف في طول العمر المناعي؟

يقدم البحث الذي قاده عالم MassCPR دوان ويسمان بعض الإجابات. يُظهر العمل أنه في حين أن الأجسام المضادة ضد السارس - CoV-2 انخفضت في معظم الأفراد بعد حل المرض ، فإن مجموعة فرعية من المرضى استمرت في إنتاج الأجسام المضادة لعدة أشهر بعد الإصابة.

كان لهذه الأجسام المضادة أيضًا مسار مرض أقصر ، مما يشير إلى أن أولئك الذين تغلبوا على المرض بشكل أسرع لديهم أيضًا مناعة دائمة ضد الفيروس. ومع ذلك ، تم الحصول على العينات المستخدمة في الدراسة من الأشخاص الذين يعانون من مرض خفيف إلى متوسط ​​ومن الأفراد المستبعدين في طرفي طيف المرض - العدوى عديمة الأعراض وأولئك الذين يعانون من مرض شديد.

استكشفت دراسة أخرى ، بقيادة عضو MassCPR ، ريتشيل تشارلز ، خبير الأمراض المعدية في Mass General ، مسألة الذاكرة المناعية في مجموعة تتألف في الغالب من الأفراد المصابين بعدوى شديدة.

أظهر العمل أن نوعًا واحدًا من الأجسام المضادة ، IgG ، استمر لمدة ثلاثة أشهر على الأقل بعد الإصابة ، مما يوفر نافذة على طول عمر الحماية المناعية بعد الإصابة. على النقيض من ذلك ، هناك نوعان آخران من الأجسام المضادة IgA و IgM تحلل في غضون شهرين ونصف أو أقل بعد الإصابة.

إعادة العدوى مقابل تساقط الشعر المستمر

علم العلماء أن عددًا قليلاً من الأشخاص قد يصابون مرة أخرى بالفيروس. لماذا تحدث مثل هذه العدوى لا يزال بحاجة إلى توضيح. ومع ذلك ، يبدو أن مجموعة فرعية أخرى من الأفراد لا تتخلص من الفيروس أبدًا ، ولكن بدلاً من ذلك تعمل على إخضاع تكاثرها إلى مستويات منخفضة مزمنة.

كان الفصل بين المجموعتين صعبًا. غالبًا ما يُطرح السؤال عندما يواجه الأطباء مرضى مصابين بـ COVID-19 موثق سابقًا ، وبعد ذلك يكون اختبارهم إيجابيًا بواسطة PCR ، وهو اختبار RNA الفيروسي.

تعرف المراكز الأمريكية لمكافحة الأمراض والوقاية منها إعادة العدوى على أنها وجود اختبار PCR إيجابي وأعراض توحي بـ COVID-19 بعد 45 يومًا على الأقل من التشخيص الأصلي لـ COVID-19. يعتبر أيضًا الشخص الذي لديه PCR إيجابيًا ثانيًا ، حتى بدون أعراض ، 90 يومًا أو أكثر بعد اختبار PCR الإيجابي الأولي ، مصابًا أيضًا بالعدوى مرة أخرى.

قال تشارلز خلال جلسة أخيرة لمجموعة العمل المسببة للمرض: "نرى هذا كثيرًا ، لكننا لا نعرف ما إذا كانت عدوى جديدة ، أو عدوى مزمنة ، أو تساقطًا طويلًا من العدوى السابقة".

وأضاف تشارلز: "السؤال الذي يهمنا هو كيف يمكن أن تختلف الاستجابة المناعية في السقائف المستمرة أو الأفراد المصابين بالعدوى المزمنة عن الأفراد القادرين على التخلص من الفيروس ، وما هي العوامل التي تجعل الأفراد عرضة للعدوى مرة أخرى". إنها تجري بحثًا مستمرًا في محاولة لتقديم بعض الإجابات.

يعمل تشارلز وزملاؤه على تحليل السمات المناعية للأجسام المضادة للمرضى عبر طيف العدوى. سوف تتعقب الدراسة تغيرات الواسمات المناعية بمرور الوقت لاستنباط الفروق الواضحة بين القاذورات المستمرة ، والأفراد المصابين بالعدوى المزمنة ، وأولئك الذين يتخلصون من الفيروس بسرعة. يمكن أن يساعد العمل أيضًا في تحديد العلامات المناعية المرتبطة بخطر إعادة العدوى.

أحد الجوانب المهمة للعدوى المزمنة هو أنها تزيد من خطر إدخال طفرات جديدة. وبالتالي ، فإن الأشخاص المصابين بالعدوى المزمنة هم مستودعات للتكاثر الفيروسي المستمر وقد يساهمون في تطوير متغيرات فيروسية جديدة أكثر ملاءمة.

التقلبات في المؤامرة

قال ألتر إن واحدة من أعظم المفاجآت حول تفاعل المضيف والممرض هو إدراك أنه عندما يتعلق الأمر بالاستجابة المناعية ، فإن الموقع مهم. في SARS-CoV-2 ، يبدو أن الجسم ينشر آليات مناعية مختلفة تحد من تكاثر الفيروس والعدوى في الشعب الهوائية العلوية مقابل الرئتين.

قال ألتر: "ليس لدينا حقًا التعامل الجيد مع هذا على الرغم من أننا كنا ندرس الإنفلونزا والسل والعديد من مسببات أمراض الجهاز التنفسي الأخرى لفترة طويلة". "لقد فتح أعيننا نوعًا ما على أهمية فهم الاستجابة المناعية الخاصة بالرئة."

تم إثبات هذا الاختلاف في بيانات اللقاح ، والتي أظهرت علامات مختلفة للمناعة التي تشير إلى أن الفيروس يتم التحكم فيه بشكل مختلف في المجرى الهوائي العلوي (الأنف والبلعوم) مقارنة بالمجرى الهوائي السفلي (القصبة الهوائية والشعب الهوائية والرئتين).

"هذا يلفت انتباهنا حقًا إلى فكرة أنه ربما يكون الأشخاص الذين يعانون من التهابات غير مصحوبة بأعراض أو خفيفة قادرين على المقاومة من خلال آليات مختلفة تمامًا عن الأشخاص الذين يدخل الفيروس فيهم إلى الرئتين ، وأن لديهم ذخيرة مناعية مختلفة تمامًا يمكنهم الاستفادة منها للقتال المرض "، قال ألتر.

ليس فقط صغار البالغين

إن الطريقة التي يؤثر بها العامل الممرض على الأشخاص من مختلف الأعمار قد أسفرت عن بعض الملاحظات المحيرة وأكبر المفاجآت في الوباء. كانت كيفية استجابة الأطفال للفيروس مفاجأة قد تقدم أدلة قيمة تتجاوز عدد الأطفال.

عادةً ما تؤدي مسببات أمراض الجهاز التنفسي - مثل تلك المسببة للإنفلونزا والسعال الديكي والسل والفيروس المخلوي التنفسي - إلى تفاقم المرض لدى الأطفال. والعكس صحيح مع SARS-CoV-2 - فقد نجا الأطفال إلى حد كبير من الأمراض الخطيرة.

قد يكون أحد التفسيرات هو أن الأطفال يميلون إلى الأداء بشكل أفضل لأنهم ربما تعرضوا مؤخرًا لفيروسات كورونا الأخرى ولديهم بعض المناعة المتقاطعة ضد هذه الفئة من الفيروسات. هناك احتمال آخر ينشأ من الاختلافات الخلوية المرتبطة بالعمر.

يغزو SARS-CoV-2 الخلايا البشرية من خلال مستقبل ACE-2 على سطح الخلايا ، وهو بوابة الغزو الفيروسي. الأطفال لديهم عدد أقل من هذه المستقبلات في خلاياهم ، وهي ملاحظة تقدم تفسيراً معقولاً لنقص المرض الشديد لدى الغالبية العظمى من الأطفال. على أي حال ، قال ألتر ، من المحتمل أن تكون القصة أكثر تعقيدًا من وجود أو عدم وجود مستقبلات ACE2 ، مما يطرح السؤال حول آليات الحماية المناعية التي قد تلعب دورًا.

قد ينشأ الاختلاف من استجابة مناعية أكثر "سذاجة" قد تحمي الأطفال من الالتهاب الشاذ الذي يغذيه المناعة والذي يظهر في المرض الشديد لدى البالغين.

وقال كنيب: "يمكن أن تكون أجهزة المناعة لدى الأطفال لا تستجيب بقوة إلى بروتين السنبلة ، الذي شاهده البالغون في الماضي ويمكن أن يؤدي إلى استجابة مناعية أكثر انحرافًا ، مما يؤدي إلى التهاب حاد ومرض أسوأ".

ومع ذلك ، يمكن لمجموعة فرعية صغيرة من الأطفال الأصحاء المصابين سابقًا بفيروس SARS-CoV-2 أن تصنع استجابة مناعية قوية وتطور حالة خطيرة ، أحيانًا مهددة للحياة ، تُعرف باسم متلازمة الالتهاب متعدد الأنظمة عند الأطفال (MIS-C).

عادة ما تظهر الحالة ، التي تشبه مرض كاواساكي ومتلازمة الصدمة السامة ، ويمكن أن تؤثر على العديد من الأعضاء بما في ذلك القلب ، بعد حوالي شهر من الإصابة بفيروس SARS-CoV-2.

وصف عضو MassCPR أدريان راندولف ، أخصائي الرعاية الحرجة وعلم الأحياء المناعي في مستشفى بوسطن للأطفال والمحقق الرئيسي في تجربة وطنية متعددة المراكز لـ COVID-19 لدى الأطفال والشباب ، تطور هذا المرض لدى الأطفال والمراهقين الذين كانوا أصحاء سابقًا. مع SARS-CoV-2.

سلطت دراسة منشورة حديثًا بقيادة راندولف الضوء على الطرق المختلفة التي يمكن أن يؤثر بها الفيروس على الأطفال والمراهقين ، مما يرسم تمييزًا مناعيًا واضحًا بين الشباب الذين يصابون بفيروس COVID-19 الخطير وأولئك الذين يطورون MIS-C.

تذكرنا حالة الأطفال هذه ببعض المتلازمات الالتهابية التي شوهدت عند البالغين ، وهو تشابه قد يشير إلى مظهر مناعي مشترك أو نمط ظاهري مناعي ، كما قال ألتر ، مع كون الشرطين مجرد نسخ للأطفال والبالغين من نفس الظاهرة الفسيولوجية.

قال ألتر: "أعتقد أن هيئة المحلفين ما زالت غير واضحة بشأن سبب حماية الأطفال بطريقة أو بأخرى من هذا الممرض التنفسي وليس الآخرين". "هذا بالنسبة لي مثل صندوق أسود كبير. إذا استطعنا فهم ذلك ، فربما يسمح لنا ذلك بالتفكير في كيفية صنع لقاحات أفضل ضد مسببات الأمراض التنفسية الأخرى أيضًا ".

قلب كوفيد -19

لقد قيل وكتب الكثير عن طيف شدة COVID-19 وقدرته على التأثير على الأشخاص بدرجات متفاوتة من الفوعة. لكن هناك جانبًا آخر محيرًا للمرض وهو التباين في نوع تلف الأعضاء الذي يمكن أن يحدثه.

بالنسبة لشخص ما ، يمكن أن يكون القلب ، ولآخر الكلى ، ولآخر الدماغ أو الرئتين. واحدة من أكبر حالات عدم اليقين هي ما إذا كانت هناك آلية أساسية توحد هذه المظاهر المتباينة.

مثال على ذلك - القلب. لا جدال في إمكانية تأثير COVID-19 على القلب. كيف يفعل ذلك لا يزال لغزا يتطور. افترض العلماء أنه قد تكون هناك عدة آليات ، لكن الكثير منها غير واضح. هناك سؤال كبير يلوح في الأفق: هل فيروس SARS-CoV-2 مجرد مضخم لمشاكل القلب الموجودة مسبقًا ، أو السبب المباشر لتوقف عضلة القلب ، أو المحرك غير المباشر لإصابة عضلة القلب؟

هذا هو السؤال الذي سيطر على جهود وتركيز عضو مجموعة العمل المرضية كريستوفر نيوتن-تشيه ، أخصائي أمراض القلب وعلم الوراثة القلبية الوعائية في Mass General وأستاذ الطب المساعد في HMS.

يعاني العديد من المرضى في المستشفى المصابين بـ COVID-19 من ارتفاعات في تروبونين ، وهو بروتين يزداد أثناء إصابة عضلة القلب الحادة ويستخدم بشكل شائع لتشخيص تلف القلب.

ومع ذلك ، فإن ما هو غير معروف هو ما إذا كانت هذه الطفرات في التروبونين تنشأ مباشرة من COVID-19 أو ما إذا كانت علامة على الإجهاد الشامل الذي يمكن أن تفرضه العدوى على أنظمة القلب والأوعية الدموية لدى الأشخاص ، كما قال نيوتن-تشيه خلال اجتماع مجموعة مسببات الأمراض مؤخرًا.

يمكن أن يضر كوفيد -19 القلب بعدة طرق ، مباشرة وغير مباشرة. على سبيل المثال ، يمكن أن تكون القشة التي يضرب بها المثل هي التي تقسم ظهر البعير وتسبب تلفًا في القلب لمن يعانون من أمراض القلب الكامنة ، حتى لو لم يتم التعرف عليها.

أو قد يتسبب في إصابة القلب عن طريق إتلاف الأوعية الدموية والتسبب في حدوث جلطات دموية ، وهو أحد المضاعفات المعروفة لـ COVID-19. قد يتسبب أيضًا في عمل القلب بجهد أكبر مما يؤدي إلى زيادة طلب العضلات على الأكسجين لإمداداتها. كما يمكن أن يتسبب الالتهاب المنتشر لفيروس كوفيد -19 في أضرار جانبية للقلب والأنسجة الأخرى.

ومع ذلك ، هناك احتمال آخر وهو أن الفيروس قد يتسلل إلى خلايا عضلة القلب ويتلفها بشكل مباشر ، مما يؤدي إلى إصابة القلب. ومع ذلك ، يلاحظ نيوتن-تشيه ، أن التقارير المرضية الناشئة من الخزعات والتشريح تشير إلى أن هذا ليس طريقًا شائعًا لتلف القلب. ومما يزيد الأمور تعقيدًا أن آلية تلف القلب تختلف على الأرجح من شخص لآخر.

يمكن أن يساعد فهم كيفية حدوث إصابة القلب أطباء القلب على تحديد ما إذا كانوا بحاجة إلى التركيز على علاج القلب على وجه التحديد أثناء مرض COVID-19 أو ما إذا كانت السيطرة على الالتهابات غير المحددة كافية لحماية العضو من ويلات COVID-19.

وأشار نيوتن-تشيه إلى أن الرئة كمصدر للالتهاب الجهازي يمكن أن تكون كافية لتقويض عمل البطين الأيسر للقلب ، حجرة الضخ الرئيسية في العضو ، والتي ترسل الدم في جميع أنحاء الجسم.

بالإضافة إلى ذلك ، فإن اضطرابات القلب تظهر بشكل شائع في المرضى ذوي الحالات الحرجة ، بغض النظر عن السبب. تشير هذه الملاحظة إلى أن الالتهاب الجهازي والضيق التنفسي يمكن أن يؤديا إلى حدوث خلل في وظائف القلب ، لكن هذا لا يعني أن COVID-19 بحد ذاته محرك فريد لإصابة القلب.

قال نيوتن-تشيه: "هناك دائمًا تحدٍ في فهم ما إذا كان وجود كميات صغيرة من الفيروس في خلايا عضلة القلب يتسبب بشكل مباشر في تدميرها أو ما إذا كان تدميرها هو أكثر من ظاهرة مناعة ذاتية". "لا أعتقد أن هذا قد تم حله على الرغم من عقود من البحث منذ التسعينيات لتوثيق وجود الجينوم الفيروسي في خلايا القلب في حالة التهاب عضلة القلب."

وبالتالي ، على الرغم من أنه من المعروف الآن أن عدوى SARS-CoV-2 يمكن أن تؤدي إلى مضاعفات في القلب ، إلا أنه لم يُعرف بعد كيف يحدث ذلك ، وما إذا كانت هذه المضاعفات عابرة أو طويلة الأمد وما إذا كانت تمثل ضررًا فيروسيًا مباشرًا عضلة القلب. أحد المؤشرات المشجعة ، وإن كان متناقلًا ، هو أن الناس يتعافون على ما يبدو.

قال نيوتن-تشيه: "إنني أتابع الأشخاص الذين عانوا من خلل وظيفي انقباضي حاد أثناء مرضهم وأصبحوا يتمتعون بوظائف طبيعية بعد بضعة أشهر".

اللعبة الطويلة لبحوث التسبب في المرض

قال ألتر وكنيب إن تراكم المعرفة على مدار العام الماضي ، إلى جانب فهم واقعي لقيود الطبيعة البشرية ، قد أسفر عن إدراك جديد: فكرة أن فيروس SARS-CoV-2 سوف يتلاشى يومًا ما قد يكون تفكيرًا سحريًا.

يتفق العديد من الخبراء الآن على أن الفيروس موجود ليبقى وأن أفضل فرصة لدينا للعودة إلى بعض مظاهر الحياة الطبيعية قد تكون إخضاع الفيروس بدلاً من القضاء عليه من خلال تحقيق مستوى من مناعة القطيع ، ويفضل أن يكون ذلك من خلال لقاح وليس طبيعيًا. عدوى.

بالنسبة لبحوث التسبب في المرض ، لا توجد لعبة نهائية حقًا.

"حتى عندما يكون لديك لقاح ، حتى عندما يكون لديك علاج ، حتى عندما يكون لديك اختبار تشخيصي ، فإن التسبب في المرض لا ينتهي. أبدا. لأننا نعلم أن هذا الفيروس لن يختفي تمامًا في أي وقت قريب.

"السلوك البشري يفرض أنه ما لم يقبل الجميع اللقاح ، فإن الفيروس لن يختفي. علاوة على ذلك ، نعلم أن هناك فيروسات كورونا أخرى باقية في الطبيعة تنتظر الحصول على فرصتها ".

إنها نقطة يعود إليها Knipe مرارًا وتكرارًا.

"التاريخ يعلمنا أننا لا نعرف من أين قد يأتي العامل الممرض التالي ، لذلك لا يمكننا أن نرفع أعيننا عن الكرة. علينا استخدام ما تعلمناه عن SARS-CoV-2 واستخدام هذه المعرفة لمواصلة البحث العلمي الأساسي في مسببات الأمراض الأخرى ".

لكن هناك سببًا أكثر جوهرية لاستمرار العمل ، كما قال ألتر وكنيب: للحفاظ على هذا التعاون الفكري الذي لم يسبق له مثيل والذي أشعلته الرحلة لفهم آليات COVID-19 والحفاظ على التفاعلات الفكرية مع زملائه العلماء. من الأوساط الأكاديمية والصناعية ومن تخصصات متنوعة مثل بيولوجيا الأنظمة والطب الحيوي الحسابي وطب الأطفال وعلم الأوبئة وعلم الوراثة وأمراض القلب والأشعة وعلم الأعصاب والغدد الصماء والمزيد.

قال ألتر: "كان لدى MassCPR هذه الرؤية المتمثلة في الجمع بين علم الأوبئة ، والعلاجات ، والتشخيص ، والطب السريري ، والمزيد لإنشاء هذه الركائز لمحاربة المرض". "الآن ، تخيل لو فعلنا الشيء نفسه مع كل مرض آخر. تخيل القيام بذلك لسرطان الثدي ، لباركنسون. فكر فقط فيما يمكننا تحقيقه إذا تمكنا من تشكيل مشاريع مانهاتن هذه ".


التهاب الصفاق المعدي القطط

FCoV هو فيروس يصيب الجهاز الهضمي. معظم الالتهابات إما بدون أعراض أو تسبب الإسهال ، خاصة في القطط ، حيث يتضاءل الجسم المضاد المشتق من الأم بين 5 و 7 أسابيع من العمر. الفيروس عبارة عن طفرة في فيروس كورونا المعوي (FECV). من القناة الهضمية ، يمر الفيروس لفترة وجيزة جدًا بمرحلة جهازية ، [3] قبل أن يعود إلى القناة الهضمية حيث يتم التخلص منه في البراز.

التسبب في FIP معقد. هناك إجماع عام على أن FIPVs تنشأ من طفرات تمكنهم من الدخول أو التكاثر بنجاح أكبر في الخلايا الأحادية (نوع من خلايا الدم البيضاء). ومع ذلك ، تظل العديد من جوانب تفاعلات الفيروس مع المضيف التي تؤثر على المرض غير مؤكدة ، مثل العوامل التي تؤثر على شكل المرض (الرطب أو الجاف) ، والنتيجة (الموت أو المقاومة) ، وقابلية المضيف للإصابة. [4]

يعتبر FCoV شائعًا في الأماكن التي توجد فيها مجموعات كبيرة من القطط معًا في الداخل (مثل بطاريات التربية ، وملاجئ الحيوانات ، وما إلى ذلك). ينتقل الفيروس في البراز وتصاب القطط بالعدوى عن طريق تناول الفيروس أو استنشاقه ، عادة عن طريق مشاركة صواني فضلات القطط ، أو عن طريق استخدام مجارف القمامة الملوثة أو الفرشاة التي تنقل جزيئات فضلات القطط المصابة إلى القطط والقطط غير المصابة. [5] يمكن أيضًا أن ينتقل FCoV من خلال سوائل الجسم المختلفة. ينتشر الفيروس بسهولة من خلال الاتصال المباشر بين القطط. أكثر أشكال الانتشار شيوعًا هو اللعاب ، حيث تشترك معظم منازل القطط المتعددة في أطباق الطعام والماء. [6] شكل رئيسي آخر من أشكال الانتشار هو الاستمالة أو القتال. عندما تقوم قطة مصابة بتربية قطة صحية ، فإنها تترك لعابها الملوث على فروها. في وقت لاحق ، عندما تذهب القطة السليمة للعناية بنفسها ، فإنها تبتلع اللعاب الملوث ثم تصاب بالعدوى. [7]

هناك نوعان رئيسيان من FIP: مفرط (مبلل) وغير مفرط (جاف). في حين أن كلا النوعين قاتلين ، فإن الشكل الانسيابي أكثر شيوعًا (60-70٪ من جميع الحالات) ويتطور بسرعة أكبر من الشكل غير الانسيابي.

انسياب (رطب) تحرير FIP

العلامة السريرية المميزة لل FIP الانسيابي هي تراكم السوائل داخل البطن أو الصدر ، مما قد يسبب صعوبات في التنفس. تشمل الأعراض الأخرى قلة الشهية والحمى وفقدان الوزن واليرقان والإسهال.

تحرير FIP غير مفرط (جاف)

سيظهر FIP الجاف أيضًا مع نقص الشهية والحمى واليرقان والإسهال وفقدان الوزن ، ولكن لن يكون هناك تراكم للسوائل. عادةً ما تظهر القطة ذات FIP الجافة علامات عينية أو عصبية. على سبيل المثال ، قد تواجه القطة صعوبة في الوقوف أو المشي ، وتصبح مشلولة وظيفيًا بمرور الوقت. فقدان البصر هو نتيجة أخرى محتملة لهذا المرض.

تشخيص تحرير FIP الانسيابي

أصبح تشخيص الشكل المفرط للمرض أكثر وضوحًا في السنوات الأخيرة. إن الكشف عن الحمض النووي الريبي الفيروسي في عينة من الانصباب (السائل الذي يتم تصريفه من الجسم) ، مثل النسخ العكسي لتفاعل البوليميراز المتسلسل (RT-PCR) هو تشخيص FIP الانسيابي. [8] [9] [10] ومع ذلك ، فإن هذا يتطلب إرسال عينة إلى مختبر بيطري خارجي. يوجد داخل المستشفى البيطري عدد من الفحوصات التي يمكن أن تستبعد تشخيص FIP المفرط في غضون دقائق:

  1. قياس البروتين الكلي في الانصباب: إذا كان أقل من 35 جم / لتر ، فإن FIP غير مرجح للغاية.
  2. قياس نسبة الألبومين إلى الجلوبيولين في الانصباب: إذا كانت أعلى من 0.8 ، يتم استبعاد FIP إذا كانت أقل من 0.4 ، فإن FIP هو تشخيص محتمل - ولكن ليس مؤكدًا. [11]
  3. افحص الخلايا في الانصباب: إذا كانت في الغالب خلايا ليمفاوية (نوع من خلايا الدم البيضاء) ، فسيتم استبعاد FIP كتشخيص.

تشخيص تحرير FIP غير الانسيابي

يعد تشخيص FIP غير الانسيابي أكثر صعوبة من تشخيص FIP الانسيابي لأن العلامات السريرية تميل إلى أن تكون أكثر غموضًا وتنوعًا: وبالتالي فإن قائمة التشخيصات التفاضلية أطول بكثير. ينبغي النظر في تشخيص FIP غير الانسيابي عند استيفاء المعايير التالية: [11]

  1. التاريخ: القطة صغيرة (أقل من سنتين) وأصيلة: أكثر من 70٪ من حالات FIP في القطط الأصلية.
  2. التاريخ: تعرض القط للإجهاد مثل الخصي أو التطعيم مؤخرًا [12]
  3. التاريخ: حصل القط على فرصة للإصابة بفيروس FCoV ، مثل نشأته في تربية أو إنقاذ قطط ، أو إدخال قطة أو قطة نقية في المنزل مؤخرًا.
  4. العلامات السريرية: أصبح القط يعاني من فقدان الشهية أو أنه يأكل أقل من المعتاد فقد وزنه أو فشل في زيادة الوزن لديه حمى مجهولة المنشأ علامات داخل العين يرقان. [13]
  5. الكيمياء الحيوية: فرط غاما غلوبولين الدم أدى إلى ارتفاع البيليروبين دون رفع إنزيمات الكبد. : lymphopenia non-regenerative - معتدل عادة - فقر الدم. : القط لديه عيار عالي من الأجسام المضادة لـ FCoV: يجب استخدام هذه المعلمة بحذر ، بسبب الانتشار الكبير لـ FCoV في بطاريات التكاثر والإنقاذ.

يمكن استبعاد FIP غير الانسيابي كتشخيص إذا كان القط سلبيًا ، بشرط أن يكون اختبار الأجسام المضادة لديه حساسية ممتازة. في دراسة قارنت بين العديد من اختبارات الأجسام المضادة لـ FCoV المتاحة تجاريًا ، [14] كان المومب المناعي FCoV (Biogal) حساسًا بنسبة 100٪ ، وكان اختبار Speed ​​F-Corona للكروماتوجرافي المناعي السريع (RIM) (Virbac) حساسًا بنسبة 92.4٪ وكان أسرع القطط التهاب الصفاق المعدي (MegaCor Diagnostik) كان اختبار RIM حساسًا بنسبة 84.6٪.

نظرًا لأن FIP هو مرض مناعي ، فإن العلاج ينقسم إلى فئتين: العمل المباشر ضد الفيروس نفسه وتعديل الاستجابة المناعية.

الأدوية المضادة للفيروسات

تحرير المنشطات المناعية

المنشطات المناعية هي الأدوية التي تجعل جهاز المناعة أكثر نشاطًا ضد الفيروس. الأدوية الأكثر شيوعًا من هذه الفئة لعلاج FIP هي إما إنترفيرون أوميغا القطني المؤتلف (Virbagen Omega ، Virbac) أو مضاد للفيروسات البشري ألفا -2 ب. نظرًا لأن النسخة البشرية يتم استهدافها من قبل الجهاز المناعي لكونها مستضدًا أجنبيًا ، فإن نسخة القطط من مضاد للفيروسات تكون أكثر فاعلية. [15]

تم تصنيع محفز مناعي تجريبي من البوليبرينيل (PI) بواسطة Sass and Sass واختباره من قبل الدكتور Al Legendre ، الذي وصف البقاء على قيد الحياة لمدة عام واحد في ثلاث قطط تم تشخيصها بـ FIP وتم علاجها بالدواء. [16] في دراسة ميدانية لاحقة على 60 قطط مع FIP غير منفردة عولجت بـ PI ، مات 52 قطط (87٪) قبل 200 يوم ، لكن ثماني قطط نجت على مدى 200 يوم من بداية علاج PI ونجا أربعة منها بعد 300 يوم. [17]

تحرير الأدوية المضادة للفيروسات

تعمل مضادات الفيروسات (بالمعنى الضيق) عن طريق التدخل في الإنزيمات أو العمليات البيولوجية الأخرى في فيروس FIP.

تم استخدام عقار تجريبي يسمى GS-441524 في تجربة ميدانية على 31 قطة. بعد 25 يومًا ، ماتت خمس قطط ، وتم علاج ثمانية ثم انتكسوا لاحقًا ، وتم علاج 18 دون أي انتكاسات لاحقة. وعولج الثمانية الذين انتكسوا مرة أخرى ، وبعضهم بجرعات أعلى. من بين هؤلاء الثمانية ، توفي واحد وشفي سبعة ، مما يعني أن 25 من 31 قطط قد شُفيت في النهاية من FIP. على الرغم من أن الدواء لم يتوفر بعد (اعتبارًا من 2019) تجاريًا في الولايات المتحدة ، إلا أن هذه الدراسة تعتبر واعدة جدًا وقد تؤدي إلى الأدوية المتاحة تجاريًا لعلاج FIP. [18] GS-441524 متوفر بنقاء 99٪ تجاريًا من موردي الكيماويات البحثية مثل Selleckchem ، [19] MedKoo [20] و MedChemExpress. [21]

تم استخدام عقار تجريبي مضاد للفيروسات يسمى GC376 في تجربة ميدانية لـ 20 قطط: 7 قطط دخلت في حالة مغفرة ، واستجابت 13 قطة في البداية لكنها انتكست وتم قتلها بطريقة رحيم. هذا الدواء ليس متاحًا تجاريًا بعد (اعتبارًا من 2017). [22]

العقاقير المضادة للالتهابات تحرير

يوصى عمومًا باستخدام عقار مضاد للالتهابات ضد FIP.

تعمل الأدوية المثبطة للمناعة على تثبيط جهاز المناعة ، مما يساعد على تقليل الالتهاب. إن الدواء المثبط للمناعة في FIP هو بريدنيزولون ، وهو كورتيكوستيرويد. لا توجد تجارب خاضعة للتحكم الوهمي تظهر أن بريدنيزولون أفضل من مضادات الالتهاب الأخرى. [23]

تحرير التطعيم

لا يوجد لقاح فعال ضد FIPV. فشل تطعيم الحمض النووي بالبلازميدات المشفرة لبروتينات FIPV في إنتاج المناعة. [24] بدلاً من ذلك ، لوحظ أن الأجسام المضادة لبروتين FIPV تؤدي إلى تفاقم المرض.

منع التحرير

يتم حماية القطط من العدوى بالأجسام المضادة المشتقة من الأم حتى الفطام ، عادة حوالي 5-7 أسابيع من العمر ، لذلك من الممكن منع إصابة القطط عن طريق إزالتها من مصادر العدوى. [25] ومع ذلك ، فإن FCoV هو فيروس شديد العدوى ومثل هذه الوقاية تتطلب نظافة صارمة.

فيلم 2018 بعنوان ايريسمن تأليف بول كاسترو جونيور وآلي ميلر وبطولة فرانك ديل وأرابيلا أوز وبيتسي إيدم ، تدور أحداث الفيلم حول قطة ولدت مع FIP يتم شراؤها من متجر للحيوانات الأليفة ويشتراها أصحابها لمدة اثني عشر يومًا. [26] [27] حصل الفيلم على جائزة في 2018 Garden State Film Festival في فئة السرد القصير [28] وفاز بجائزة Kahuna الذهبية في حفل توزيع جوائز هونولولو السينمائي لعام 2018. [29]


خيارات الوصول

احصل على حق الوصول الكامل إلى دفتر اليومية لمدة عام واحد

جميع الأسعار أسعار صافي.
سيتم إضافة ضريبة القيمة المضافة في وقت لاحق عند الخروج.
سيتم الانتهاء من حساب الضريبة أثناء الخروج.

احصل على وصول محدود أو كامل للمقالات على ReadCube.

جميع الأسعار أسعار صافي.


كيف يمكن أن تؤدي طفرة الفيروسات إلى فقدان ملاءمتها للأجسام المضادة دون فقدان ملاءمة مستضد الخلايا التي تصيبها؟ - مادة الاحياء

يمكن أن يكون التغيير التطوري التكيفي للفيروسات داخل المضيف ضارًا بانتقالها (التطور قصير النظر).

من المرجح أن يكون فقدان القابلية للانتقال هو الأكثر إشكالية بالنسبة للعدوى الفيروسية المستمرة (المزمنة) سريعة التطور.

يمكن للمجموعات الفيروسية داخل المضيف أو المجموعات السكانية الفرعية أن تظهر معدلات تطور أقل كما هو متوقع.

من المحتمل أن يحدث الانتقاء عند نقطة الانتقال ، وغالبًا ما يؤدي إلى إصابة فيروسات واحدة أو عدة فيروسات جديدة.

تم اقتراح الانتقال التفضيلي للفيروسات الشبيهة بالمؤسس والتي خضعت لتطور ضئيل داخل المضيف.

مع فترات التوليد القصيرة للغاية والقدرة العالية على التحور ، يمكن للعديد من الفيروسات أن تتطور بسرعة وتتكيف مع البيئات المتغيرة. هذه القدرة مفيدة بشكل عام للفيروسات لأنها تتيح لها تجنب الاستجابات المناعية للمضيف ، وتطوير سلوكيات جديدة ، واستغلال المنافذ البيئية. ومع ذلك ، فإن الانتقاء الطبيعي يولد عادة التكيف استجابة لضغوط الاختيار الفورية التي يتعرض لها الفيروس في مضيفه الحالي. وبالتالي ، فإننا نجادل بأن بعض الفيروسات ، لا سيما تلك التي تتميز بفترات طويلة من العدوى والتكرار المستمر ، قد تكون عرضة للتطور قصير النظر ، حيث يكون تكيف الفيروس مع مضيفه الحالي ضارًا بانتقاله داخل المجتمع المضيف. هنا نحدد مفهوم التطور الفيروسي قصير النظر ونقدم أمثلة على كيفية تأثيره سلبًا على الانتقال الفيروسي بين المضيفين. نقترح أيضًا أن الفيروسات المعرضة للتطور قصير النظر قد تعرض استراتيجيات تقلل من آثارها. نحن نتكهن بالآليات المختلفة التي يمكن من خلالها تحقيق ذلك ، بما في ذلك استراتيجيات تاريخ الحياة الفيروسية التي تؤدي إلى معدلات منخفضة للتطور داخل المضيف ، أو إنشاء سلالة "جرثومية" للفيروسات التي تتجنب التطور قصير النظر. توفر هذه المفاهيم منظورًا جديدًا للطريقة التي تمكنت بها بعض الفيروسات من إنشاء الأوبئة العالمية والحفاظ عليها.


دور خلايا CD4 T في الإصابة بفيروس نقص المناعة البشرية

أحد ألغاز الإصابة بفيروس نقص المناعة البشرية هو أن الخلايا ذاتها التي يُقصد بها بدء الدفاع المناعي هي نفسها الخلايا المستهدفة للعدوى بفيروس نقص المناعة البشرية. كفيروس ارتجاعي ، يحتاج فيروس نقص المناعة البشرية إلى إصابة خلايا "مضيفة" معينة من أجل صنع نسخ منه. خلايا CD4 هي الأهداف الرئيسية لهذا في سياق العدوى.

أثناء العدوى ، يرتبط فيروس نقص المناعة البشرية بهذه الخلايا المساعدة ، مما يؤدي إلى إفراغ مادته الجينية في الداخل بحيث يمكن تغيير الترميز الجيني للمضيف لإنتاج فيروسات أخرى لفيروس نقص المناعة البشرية. عند القيام بذلك ، يتم قتل خلية CD4 المضيفة. يتم استنفاد قدرة الشخص المصاب على إطلاق دفاع مناعي تدريجيًا إلى درجة تجعل الجسم عرضة للعدوى الانتهازية.

إن ديناميكيات فيروس نقص المناعة البشرية تجعل الخلايا التائية CD8 "القاتلة" تُترك عمياء بشكل متزايد في حالة العدوى المتقدمة وتصبح في النهاية غير قادرة على التعامل مع العدد المتزايد لفيروس نقص المناعة البشرية (كما يقاس بالحمل الفيروسي).

إذا تُركت عدوى فيروس نقص المناعة البشرية دون علاج ، فسوف ينهار الجهاز المناعي تمامًا (أو يصبح عرضة للخطر) في جميع الحالات باستثناء الحالات النادرة.


النمذجة داخل ديناميكيات عدوى SARS-CoV-2 المضيفة والعلاجات المحتملة

15٪) والعكس صحيح. المعلمات الأخرى مثل معدل موت الخلايا المصابة (أ) تمارس تأثيرات معاكسة. تؤدي زيادة I بنسبة 20٪ إلى تقليل الحمل الفيروسي الأقصى بنسبة 12٪ ، على الرغم من أن التأثير على ظهور المرض وتلف الخلايا ضئيل. شدة المرض غير حساسة نسبيًا للتغيرات في المعلمات الأخرى مثل معدل إنتاج خلايا البلازما (b P M) أو معدل فقدان خلايا تقديم المستضد (a M). قد تفسر الحساسية الكبيرة للتنبؤات النموذجية للتغيرات في بعض المعلمات التباين الكبير في بداية ومدة وشدة عدوى SARS-CoV-2.

3.3 محاكاة Remdesivir

5 ميكرومتر Remdesivir في دراسة في المختبر بواسطة Wang et al. [23] (الشكل 1 ، اللوحة أ). باستخدام هذه المعلمات ، في اليوم الثالث ، يتنبأ النموذج بفرقين من حيث الحجم في الحمل الفيروسي بين مجموعة التحكم والمجموعات المعالجة. تظهر هذه النتائج في الشكل 4 أ ، جنبًا إلى جنب مع قياسات الحمل الفيروسي في سائل غسل القصبات الهوائية المكاك ريسوس ، التي تم الحصول عليها بعد التلقيح لمدة 3 أيام (البيانات المستخرجة من الشكل 2 أ في المرجع [22] ، معدلة لحجم الإنسان). علاوة على ذلك ، يتنبأ النموذج بتلف الخلايا بنسبة 37٪ و 7٪ في حالة التحكم والحالة المعالجة ، على التوالي. تظهر هذه النتائج في الشكل 4 ب ، ومقارنة مع المنطقة الكسرية المتأثرة بالآفات الإجمالية على السطح الظهري لفص الرئة الأيسر من قرود المكاك الريسوس (الشكل 5 أ في المرجع. [22]). تتوافق توقعات النموذج هذه إلى حد كبير مع البيانات التجريبية.

3.4. منع دخول الخلية المضيفة

35٪). بالنسبة للعقار ذو الفعالية المتوسطة الذي يمنع دخول الخلايا الفيروسية بنسبة 50٪ ، إذا تم تناوله لمدة أسبوع أو أقل بعد التعرض للفيروس ، فيمكن أن يقتصر تلف الخلايا على 20٪ ، على الرغم من أن الحد الأقصى للحمل الفيروسي لا ينخفض ​​بشكل كبير. ومع ذلك ، فإن التأخير الأطول سيجعل العلاج غير فعال. الدواء الأقل فعالية الذي يمنع دخول الخلايا الفيروسية بنسبة 25٪ له تأثير وقائي محدود فقط على الخلايا المضيفة.


المواد والأساليب

خطوط الخلايا والخلايا الأولية

تم الحفاظ على خلايا الكلى Madin-Darby Canine (MDCK) وخلايا الكلى الجنينية البشرية 293T (HEK293T) في وسط كامل (CM) يتكون من Dulbecco's Modified Eagle Medium (DMEM) المضاف إليه 10 ٪ من مصل بقري جنيني ، 100U / مل بنسلين / ستربتومايسين ( Life Technologies) و 2 مليون M Glutamax (Gibco). تم عزل الخلايا الظهارية للأنف البشرية (hNEC) من أنسجة المتبرع غير المريضة بعد جراحة الجيوب الأنفية بالمنظار. نمت الخلايا وتمييزها وصيانتها في واجهة الهواء السائل كما هو موضح سابقًا [46]. تم تحضير وسيط التمايز ووسط الصيانة hNEC كما هو موصوف سابقًا [46-48]. تم استخدام مزارع hNEC لمنحنيات نمو منخفضة MOI فقط عندما تكون متباينة تمامًا. تم الحفاظ على جميع الخلايا عند 37 درجة مئوية في حاضنة مرطبة مكملة بـ 5 ٪ من ثاني أكسيد الكربون2.

البلازميدات

تم استخدام البلازميد pH21 لتوليد أنفلونزا كاملة الطول (HA) أو نورامينيداز (NA) البلازميدات لإنتاج الفيروس المؤتلف. باختصار ، تم عزل الحمض النووي الريبي الفيروسي من فيروسات clade 3c.2a H3N2 A / Bethesda / P0055 / 2015 (245 NA Gly + ID 253812) و A / Columbia / P0041 / 2014 (245 NA Gly- ID 253817) باستخدام Qiagen mini-vRNA طقم العزل. تم استخدام الاشعال الخاص بالجينات مع مواقع الاستنساخ للنيورامينيداز H3N2 أو الهيماجلوتينين لإنشاء (كدنا) عبر تفاعل RT-PCR بخطوة واحدة (مزيج SuperScript III-Platinum Taq ، ThermoFisher Scientific). تم قطع منتجات (كدنا) باستخدام إنزيمات تقييد مناسبة ، وتنقية العمود (مجموعة تنقية QIAquick PCR) وربطها باستخدام إنزيم مقيد pH21 باستخدام T4-ligase (New England Biolabs ، NEB). تم تحويل منتجات الربط إلى خلايا DH5a (NEB) وتم تحضير المستعمرات المصغرة (QIAprep spin mini-prep) والتحقق من تسلسل Sanger. كانت المستعمرات التي تم التحقق من تسلسلها مكسورة الإعداد (ZymoPURE) واستخدمت في تحضير الفيروس المؤتلف. نظرًا لأن تسلسل الأحماض الأمينية HA بين A / Bethesda / 55/2015 مطابق لـ A / Columbia / 41/2014 ، تم استخدام بلازميد A / Bethesda / 55/2015 HA-pHH21 لكل من فيروسات H3N2. تم تعديل الكودون في موضع الأحماض الأمينية 160 في HA (ترقيم H3 ، Threonine) عن طريق الطفرات الموجهة للموقع (Agilent) من النوع البري (ACA ، Thr) إلى كودون جديد (ACT ، Thr) أقل احتمالًا للعودة إلى ليسين. codon- الذي حدث كثيرًا أثناء المحاولات السابقة لإنقاذ الفيروسات.

تم تصنيع H6 hemagglutinin-pHH21 بواسطة Genscript (www.genscript.com) في ناقل pHH21. تم إدخال تسلسل ترميز H6 HA من A / Environment / Hubei-Jinzhou / 02/2010 [49] في الرقم الهيدروجيني pH21 المحاط بـ H3 5 '(GCAAAAGCAGGGATAATTCTATTAACC) و 3 بوصات (تااجتجكاتاتااااكاكككتجتتكتاكتا) تسلسلات UTR. بعد تخليق الجينات ، تمت إضافة طفرتين (Q223L و G225S) في تسلسل ترميز HA لزيادة ارتباط بروتين HA بحمض السياليك 2،6 [50]. تم تحويل منتج الجين إلى DH5a (NEB) وتجهيزه الأقصى لإنتاج الفيروس المؤتلف. تم إنشاء بلازميدات pHH21 التي تشفر الأجزاء الداخلية لـ A / Victoria / 361/2011 (H3N2 ، فيروسات rVic المؤتلفة) أو A / WSN / 33 (فيروسات H6N2 ، rWSN المؤتلفة) على النحو الموصوف سابقًا [51].

تم استخدام البلازميد pCAGGS للتعبير العابر عن بروتينات NA Gly + أو NA Gly- neuraminidase التي تحمل علامة C الطرفية. تمت إضافة علامة العلم C-terminal (DYKDDDDK) إلى بلازميدات ترميز pHH21-NA عبر الطفرات الموجهة للموقع (Agilent). تم إنشاء (كدنا) من بلازميدات علم الرقم الهيدروجيني 21-NA باستخدام Q5 Hot-Start PCR (NEB). تم بعد ذلك استنساخ منتج (كدنا) هذا في ناقل تعبير الثدييات pCAGGS لتجارب تعداء عابرة كما هو موضح سابقًا [52].

إنتاج الفيروسات المؤتلف

تم إنشاء فيروسات H3N2 أو H6N2 المؤتلفة باستخدام نظام الجينات العكسية المكون من 12 بلازميد كما تم وصفه سابقًا [51]. لفترة وجيزة تم طلاء خلايا HEK293T عند التقاء 50 ٪ قبل يوم واحد من تعداء العدوى في وسائط كاملة. في يوم تعداء العدوى ، تم استبدال الوسائط بـ Opti-MEM الخالي من المصل. تم بعد ذلك نقل HEK293Ts بثمانية بلازميدات ترميز مقاطع إنفلونزا كاملة الطول في ناقل pHH21 (PB2 ، PB1 ، PA ، HA ، NP ، NA ، M ، NS) وأربعة بلازميدات تشفر بروتينات تكرار الإنفلونزا في ناقل PCDNA3.1 (PB2 ، PB1 و PA و NP). في يوم واحد بعد تعداء 5 ميكروغرام / مل تمت إضافة N- أسيتيل التربسين إلى تفاعل تعداء. تم وضع خلايا MDCK فوق أربع ساعات بعد علاج التربسين. تم أخذ عينات من فيروس تراكب MDCK الذي يحتوي على مادة طافية كل 24 ساعة لإنتاج الفيروس. تمت إضافة Fresh Opti-MEM مع 5 ميكروغرام / مل من N-acetyl trypsin عند أخذ عينة. تم تنقية الفيروس من طاف الخلية المنقولة من البلاك كما هو موضح أدناه ، متسلسلًا ، واستخدامه لتوليد مخزون البذور عن طريق إصابة خلايا MDCK عند وزارة الداخلية البالغة 0.001. تم إنشاء مخزونات العمل من مخزونات البذور المؤكدة بالتسلسل عن طريق إصابة خلايا MDCK عند وزارة الداخلية بقيمة 0.001 كما هو موضح أدناه.

فحص البلاك

نمت خلايا MDCK في وسط كامل إلى التقاء 100 ٪ في 6 لوحات جيدة. تمت إزالة الوسط الكامل ، وغُسلت الخلايا مرتين باستخدام برنامج تلفزيوني يحتوي على 2 مم من مغنيسيوم الكالسيوم (PBS +) وأضيف 400 ميكرولتر من اللقاح. تم تحضين الخلايا عند 32 درجة مئوية لمدة ساعة مع التأرجح كل 15 دقيقة. بعد ساعة واحدة ، تمت إزالة لقاح الفيروس واستكمل DMEM الخالي من الفينول الأحمر بـ 3 ٪ BSA (Sigma) ، 100U / ml Pen / strep (Life Technologies) ، 2mM Glutamax (Gibco) ، 5mM HEPES buffer (Gibco) 5 ميكروغرام / مل N- تمت إضافة أسيتيل التربسين (سيغما) و 1٪ [اغروس). تم تحضين الخلايا عند 32 درجة مئوية لمدة 3-5 أيام ثم تثبيتها بـ 4٪ فورمالديهايد. بعد إزالة الاغاروز ، كانت الخلايا ملطخة بالنافثول الأسود الأزرق. تم تحليل حجم البلاك في ImageJ [53]. لإنتاج الفيروس المؤتلف ، تم التقاط لويحات الفيروس باستخدام ماصة بدلاً من تثبيتها بالفورمالديهايد ووضعها في العضل وتخزينها عند -80 درجة مئوية لتوليد مخزون البذور لاحقًا.

بذور الفيروس ومخزونات العمل

لتوليد مخزون بذور الفيروس المؤتلف ، تمت إضافة 400 ميكرولتر من الفيروس المختار من البلاك إلى خلايا MDCK المتكدسة المطلية في 6 لوحات آبار وإصابتها لمدة ساعة واحدة كما هو موصوف سابقًا [50 ، 52]. تمت إزالة لقاح البلاك وأضيفت وسائط العدوى (IM). وسط العدوى (IM) ، يتكون من DMEM مع 0.3٪ BSA (Sigma) ، 100U / ml قلم / strep (Life Technologies) ، 2 ملي مولار Glutamax (Gibco) و 5 ميكروغرام / مل N-acetyl trypsin ((Sigma)). تم وضع الخلايا في حاضنة 32 درجة مئوية ومراقبتها يوميًا من أجل CPE. تم حصاد مخزون البذور بين 3 و 5 أيام أو عندما بلغ CPE حوالي 75-80٪. تم بعد ذلك ترتيب مخزونات البذور وتحديد عيار الفيروسات المعدية بواسطة TCID50. تم إنشاء مخزون عامل لكل فيروس عن طريق إصابة خلايا MDCK المتكدسة في دورق T75 في وزارة الداخلية من 0.001 لمدة ساعة واحدة عند 32 درجة مئوية. تمت إزالة اللقاح ، وتمت إضافة IM. تم رصد الخلايا يوميًا من أجل CPE وتم حصاد المخزون العامل عندما بلغ CPE حوالي 75-80 ٪. تم التحقق من تسلسل المخزونات العاملة وتحديد الفيروس المعدي عبر TCID50 كما هو موضح أدناه.

التهابات منخفضة وزارة الداخلية

تم إجراء منحنيات النمو منخفضة وزارة الداخلية في وزارة الداخلية .001 في خلايا MDCK و .01 في ثقافات hNEC. تم إجراء عدوى خلايا MDCK كما هو موضح أعلاه. بعد الإصابة ، تمت إزالة اللقاح وغسل خلايا MDCK ثلاث مرات باستخدام PBS +. بعد الغسيل ، تمت إضافة IM ووضع الخلايا عند 32 درجة مئوية. في الأوقات المحددة بعد التلقيح ، تمت إزالة IM من خلايا MDCK وتجميدها عند -80 درجة مئوية. ثم تمت إضافة رسائل فورية حديثة. بالنسبة لمنحنيات النمو منخفضة وزارة الداخلية في وجود الأجسام المضادة وحيدة النسيلة ، تمت إضافة الأجسام المضادة المشار إليها إلى IM بعد السماح للفيروس بالالتصاق بالخلايا. في منحنيات نمو hNEC منخفضة وزارة الداخلية ، تم غسل السطح القمي ثلاث مرات باستخدام برنامج تلفزيوني وتم تغيير الوسائط القاعدية في وقت الإصابة. تم تلقيح ثقافات hNEC في وزارة الداخلية من .01. ثم تم وضع مزارع hNEC في حاضنة 32 درجة مئوية لمدة ساعتين. بعد التلقيح ، تم غسل hNECs ثلاث مرات باستخدام برنامج تلفزيوني. في الأوقات المحددة ، تمت إضافة 100 ميكرولتر من IM بدون N-acetyl trypsin إلى السطح القمي لـ hNECs. تم تحضين hNECs بعد ذلك لمدة 5 دقائق عند 32 درجة مئوية وتم حصاد IM وتجميده عند -80 درجة مئوية. تم تغيير الوسائط القاعدية كل 48 ساعة بعد الإصابة طوال مدة التجربة.

TCID50

تم زرع خلايا MDCK في لوحة 96 بئر قبل يومين من الفحص ونمت إلى التقاء 100 ٪. تم غسل الخلايا مرتين باستخدام PBS + ثم تمت إضافة 180 ميكرولتر من IM إلى كل بئر. تم إنشاء تخفيفات متسلسلة للفيروس بعشرة أضعاف ثم تمت إضافة 20 ميكرولتر من تخفيف الفيروس إلى خلايا MDCK. تم تحضين الخلايا لمدة 6 أيام عند 32 درجة مئوية ثم تم تثبيتها بـ 2٪ فورمالدهيد. بعد التثبيت ، كانت الخلايا ملطخة بالنافثول الأزرق والأسود وغسلها وتم حساب عيار الفيروس [50 ، 52].

تعداء عابر للخلايا التي تعبر عن علم NA

تم إجراء تعداء عابر لـ HEK293T باستخدام TransIT-LT1 وفقًا لبروتوكول الشركات المصنعة. باختصار ، نمت الخلايا في وسط كامل حتى وقت تعداء الخلايا إلى ما يقرب من 50 ٪ من الالتقاء. في يوم تعداء العدوى ، تمت إزالة الوسط الكامل واستبداله بوسيط خالٍ من مصل Opti-MEM. تم خلط Opti-MEM و TransIT-LT1 و 2.5 ميكروغرام من الجين المشفر للبلازميدات ثم إضافتها إلى خلايا HEK293T. في 16 ساعة بعد ترنسفكأيشن تم استخدام آبار لتحليل التدفق الخلوي.

الأجسام المضادة NA

تم استخدام الأجسام المضادة وحيدة النسيلة الخاصة بـ NA 229-1G03 و 235-1C02 و HCA2 لتقييم الارتباط ببروتينات NA. تم توفير 229-1G03 و 235-1C02 بواسطة باتريك ويلسون [20]. يرتبط 235-1C02 بالبقايا 249 و 428 على بروتين NA كما هو موصوف ويرتبط 229-1G03 بحاتمة غير مميزة حتى الآن على بروتين N2 NA. تم توفير الجسم المضاد أحادي النسيلة HCA-2 بواسطة Sean Li [18]. يرتبط HCA-2 بحاتمة معروفة ومحفوظة للغاية في الموقع النشط لبروتين NA ، البقايا 222-230 ILRTQESEC. لتقييم ارتباط الجسم المضاد ببروتينات NA المعبر عنها ، تم تخفيف جميع الأجسام المضادة أحادية النسيلة إلى 1 ميكروغرام / مل 1X PBS (بيولوجيا الجودة) التي تحتوي على 0.1 ٪ BSA ، (Sigma) تم استخدامها في جميع أنحاء بروتوكول تلطيخ الأجسام المضادة (FACS buffer). تم بعد ذلك تخفيف الأجسام المضادة بشكل متسلسل بنسبة 1: 2 في المخزن المؤقت لنظام مراقبة الأصول الميدانية. تم تخفيف الماوس المضاد لـ FLAG (استنساخ M2 ، Sigma) في المخزن المؤقت FACS إلى 1 ميكروغرام / مل. بالنسبة للفأر النشاف الغربي ، تم تخفيف الأجسام المضادة لـ FLAG والمضادة للأنفلونزا M1 إلى 2 ميكروغرام / مل في منع المخزن المؤقت. تم تخفيف الأجسام المضادة في IM لفحوصات تحييد الفيروس. لتثبيط الفيروس منحنى نمو MOI المنخفض ، تم تخفيف الأجسام المضادة المثبطة لـ NA في IM + 5μg N-Acetyl Trypsin. تم تخفيف 229-1G03 إلى 1.5 نانومتر ، 235-1 C02 1.3 نانومتر ، واستنساخ IgG البشري من النوع IGHG1 المخفف إلى 5 نانومتر.

الأجسام المضادة الثانوية

تم استخدام الأجسام المضادة الثانوية للكشف عن ارتباط الأجسام المضادة وحيدة النسيلة الأولية غير المقترنة. تم استخدام Goat anti-Mouse IgG Alexa Fluor 488 و Goat anti-Rabbit IgG Alexa Fluor 647 و Goat anti-Human IgG Alexa Fluor 647 بتركيز 1 ميكروغرام / مل في محلول FACS (ThermoFisher Scientific). من أجل النشاف الغربي ، تم تخفيف جميع الأجسام المضادة الثانوية في منع المخزن المؤقت بتركيز 1 ميكروغرام / مل.

مصل بشري

تم استخدام مصل بشري في فترة النقاهة تم الحصول عليه من خلال دراسة JH-CEIRS (HHSN272201400007C) في هذه الدراسة. عولجت عينات المصل بإنزيم يدمر المستقبلات (Cosmos Biological) ومعالجتها حرارياً وفقاً لبروتوكول الشركات المصنعة لاستخدامها في دراسات ELLA.

التدفق الخلوي

تم فصل خلايا HEK293T باستخدام .05٪ Trypsin-EDTA (تقنيات الحياة) وتم إصلاحها بنسبة 2٪ بارافورمالدهيد (Affymetrix) في درجة حرارة الغرفة لمدة 15 دقيقة. تم غسل الخلايا باستخدام محلول FACS بعد التثبيت وتلطيخها بالكميات المشار إليها من الأجسام المضادة أحادية النسيلة البشرية أو الأرانب والأجسام المضادة أحادية النسيلة المضادة لـ FLAG. تم غسل الخلايا مرتين في زبدة FACS بين كل خطوة حضانة للجسم المضاد. تم تحليل الخلايا على BD-FACS Calibur وتم تحليل البيانات باستخدام برنامج FlowJo V10.5.3. تم استخدام المتوسط ​​الهندسي لتحديد متوسط ​​شدة التألق (MFI).

تنقية جزيئات الفيروس جزئيًا

تمت تنقية الفيروس جزئيًا عن طريق التنبيذ الفائق فوق وسادة السكروز من أجل SDS-PAGE والنشاف الغربي. تم وضع مادة طافية لمخزون عامل الفيروس الموضح على 25 ٪ من السكروز- NTE (100 نانومتر كلوريد الصوديوم (ThermoFisher Scientific) ، 10 مللي M Tris (Promega) و 1 مللي M EDTA (Sigma)) المخزن المؤقت. تم طرد الفيروس عند 27000 دورة في الدقيقة في دوار SW-28 في Beckman Coulter Optima L90-K UltraCentrifuge لمدة ساعتين. بعد أول تنبيذ فائق ، تمت إزالة المادة الطافية. تم إعادة تعليق بيليه الفيروس في برنامج تلفزيوني. تم تركيز الحبيبات بشكل أكبر عن طريق الطرد المركزي الفائق في دوار SW-28ti عند 23000 دورة في الدقيقة لمدة ساعة واحدة. تم إعادة تعليق الحبيبات في برنامج تلفزيوني لاستخدامها في نشاط NA والنشاف الغربي ومقايسات PNGase.

PNGase و SDS-PAGE والنشاف الغربي

تم استخدام جزيئات الفيروس المنقى جزئيًا في SDS-PAGE. بالنسبة إلى معالجة PNGase ، تم استخدام مجموعة PNGase من (NEB) وفقًا لتعليمات الشركة المصنعة. بعد معالجة PNGase ، تمت معالجة جميع العينات باستخدام محلول 4X-Laemli (Bio-Rad) يحتوي على 250 ملي مولار ديثيوثريتول (DTT ، ThermoFisher Scientific) وتم غليها عند 100 درجة مئوية لمدة 5 دقائق. تم تشغيل العينات على 4-20 ٪ من المواد الهلامية Mini-PROTEAN TGX (Bio-Rad) بدقة All-Blue بالإضافة إلى سلم البروتين (Bio-Rad) عند 70 فولت. تم نقل البروتينات إلى غشاء immobilon-FL (ميليبور) عند 75 فولت لمدة ساعة واحدة. بعد النقل ، تم حظر الأغشية بمحلول مانع للتسرب (يحتوي PBS على 0.05٪ توين -20 (سيغما) و 5٪ حليب خالي من الدسم (بيو راد)) لمدة ساعة واحدة عند درجة حرارة الغرفة. تم تحضين الجسم المضاد الأولي (HCA2 و anti-M1) طوال الليل عند 4 درجات مئوية في محلول مانع للتسرب. تم غسل الأغشية في برنامج تلفزيوني بنسبة 0.05٪ توين -20 (محلول غسيل مؤقت). تمت إضافة الجسم المضاد الثانوي لمدة ساعة واحدة عند درجة حرارة الغرفة (25 درجة مئوية) في محلول منع ثم غسله مرة أخرى في محلول غسيل. تم تصوير البقع وتحليلها باستخدام نظام FluorChem Q (بروتين بسيط).

غير متاح-نجمة فحص

تم إجراء اختبار NA-Star Influenza Neuraminidase Inhibitors Resistance Detection Kit وفقًا لمواصفات المصنِّع (ThermoFisher Scientific). باختصار ، تم خلط تخفيفين متسلسلين من المصل البشري أو الأجسام المضادة وحيدة النسيلة في محلول اختبار NA-STAR. تمت إضافة حجم متساوٍ من الفيروس المنقى جزئيًا المخفف في محلول اختبار NA-Star إلى تخفيفات الجسم المضاد. تم وضع هذا الخليط من الفيروس والأجسام المضادة في صفيحة معتمّة بيضاء اللون تحتوي على 96 جيدًا وحضنت في درجة حرارة الغرفة لمدة 30 دقيقة مع اهتزاز أفقي برفق. بعد الحضانة ، 10 ميكرولتر من 1X NA-نجمة تمت إضافة الركيزة وحضنت الألواح عند درجة حرارة الغرفة لمدة 30 دقيقة إضافية أثناء الرج. بعد إضافة الركيزة ، تمت إضافة مسرع وقراءة اللوحات على الفور عن طريق قياس اللمعان على قارئ الصفيحة الدقيقة متعدد الأوضاع FilterMax F5. لتقييم نشاط NA الإجمالي ، لم تتم إضافة أي جسم مضاد أحادي النسيلة. تم تحليل البيانات في المنشور (GraphPad) وتم تعريف التثبيط بنسبة 50٪ كجسم مضاد أو تركيز مصل أدى إلى تثبيط نشاط NA بنسبة 50٪ على الأقل مقارنة بالفيروس بدون جسم مضاد.

إنزيم مرتبط بالمقايسة

تم إجراء فحوصات الليكتين المرتبطة بالإنزيم (ELLA) كما سبق [31 ، 32]. تم طلاء ألواح Nunc MaxiSorp ذات القاع المسطح (ThermoFisher Scientific) بـ 100 ميكرولتر من فيتوين (سيغما) عند 25 ميكروغرام / مل. تم حفظ الألواح عند 4 درجات مئوية لمدة 18 ساعة على الأقل ، حتى شهر واحد قبل الاستخدام. تم تخفيف الأجسام المضادة أحادية النسيلة أو المصل البشري أو الأوسيلتاميفير بشكل متسلسل مرتين في محلول ملحي مخزّن من فوسفات Dulbecco مع الكالسيوم والمغنيسيوم (ThermoFisher Scientific) يحتوي على 1٪ BSA (Sigma) و 0.2٪ Tween-20 (يشار إليه باسم محلول العينة). تم إجراء التخفيفات في 60 ميكرولتر في نسختين على لوح بئر Nunclon Delta Surface Round 96. تمت إضافة الفيروس إلى عينة المخزن المؤقت ، وتمت إضافة 60 ميكرولتر من الفيروس إلى لوحة التخفيف. تم استخدام فيروس H3N2 المؤتلف لتجارب الأجسام المضادة أحادية النسيلة والمثبط. بالنسبة لمصل الدم البشري ، تم استخدام فيروس H6N2 المؤتلف. تمت معادلة محتوى NA عن طريق النشاف الغربي لـ H3N2 أو معادلة محتوى الفيروس عن طريق فحص البلاك لـ H6N2. تم غسل الألواح المطلية بالفيتوين مباشرة قبل إضافة 100 ميكرولتر من الفيروس المخلوط مسبقًا بالأجسام المضادة أو المصل أو الأوسيلتاميفير. تم تغطية الصفائح بغطاء بلاستيكي ثم وضعها في حاضنة 37 درجة مئوية مع 5٪ C02 لمدة 16-18 ساعة بين عشية وضحاها. في اليوم التالي ، تم غسل الأطباق ست مرات باستخدام برنامج تلفزيوني يحتوي على 0.05 ٪ توين 20 (يشار إليها باسم PBST). بعد الغسل الأخير ، تمت إضافة 100 ميكرولتر من ليكتين الفول السوداني المعالج بيوتينيل عند 1 ميكروغرام / مل إلى كل بئر وحضنت في درجة حرارة الغرفة لمدة ساعتين. بعد إضافة لكتين الفول السوداني ، تم غسل الأطباق ثلاث مرات باستخدام PBST. بعد ذلك ، تمت إضافة 100 ميكرولتر من بيروكسيديز الفجل الستربتافيدين-حصان (ميليبور سيغما) إلى كل بئر وحضنت الأطباق في درجة حرارة الغرفة لمدة ساعة واحدة. تم بعد ذلك غسل الألواح 3 مرات باستخدام PBST قبل إضافة 100 ميكرولتر من 0.5 مجم / مل ا- فينيلنديامين (سيغما) مخفف في محلول سيترات الفوسفات مع بيربورات الصوديوم (سيغما).تم تحضين الألواح لمدة 10 دقائق عند درجة حرارة الغرفة وتم إيقاف التفاعلات وتطويرها بإضافة 100 ميكرولتر من 2 نيوتن حمض الكبريتيك المخفف في الماء. تمت قراءة الامتصاصية عند 405 نانومتر على قارئ الصفيحة الدقيقة متعدد الأوضاع FilterMax F5 (الأجهزة الجزيئية). لتقييم نشاط NA ، لم تتم إضافة أي جسم مضاد أحادي النسيلة. تم تحليل البيانات في المنشور (GraphPad8) وتم تعريف التثبيط بنسبة 50٪ كجسم مضاد أو تركيز مصل أدى إلى تثبيط نشاط NA بنسبة 50٪ على الأقل مقارنة بالفيروس بدون جسم مضاد.

مقايسة NA- فلور

تم إجراء مقايسة إنفلونزا NA-Fluor Neuraminidase وفقًا لمواصفات الشركة المصنعة وتجارب حركية الإنزيم التي تم إجراؤها كما ورد سابقًا [54]. بالنسبة لحركية الإنزيم ، تم تخفيف ركيزة MUNANA بشكل متسلسل مرتين في المخزن المؤقت للمقايسة على لوح بئر أسود معتم 96. تم تحضير الفيروس في المخزن المؤقت للمقايسة ثم أضيف إلى اللوحة التي تحتوي على تخفيفات الركيزة MUNANA. تم قياس الإسفار كل 60 ثانية لمدة ساعة واحدة بعد إضافة الفيروس على قارئ الصفيحة الدقيقة متعدد الأوضاع FilterMax F5 (الأجهزة الجزيئية). تم حساب Enzyme Vmax و Km باستخدام برنامج Prism (GraphPad).

NA مقايسة الأجسام المضادة المعادلة

لتقييم قدرة الأجسام المضادة وحيدة النسيلة على منع تكاثر الفيروس ، تم إجراء اختبار معادل. تم طلاء خلايا MDCK بنسبة 100 ٪ على 96 طبقًا جيدًا وغسلها مرتين باستخدام PBS +. تم إجراء تخفيف تسلسلي مزدوج من الجسم المضاد أحادي النسيلة في IM + 5 ميكروغرام / مل N-acetyl trypsin بتركيز ابتدائي 100 نانومتر في حجم 60 ميكرولتر في نسختين على ألواح Nunclon ذات قاع مستدير. بعد ذلك ، تمت إضافة 60 مايكرولتر (إجمالي 2000 PFU) من 245 NA Gly + أو 245 NA Gly- H3N2 المؤتلف المخفف في العضل مع 5 ميكروغرام / مل N-Acetyl Trypsin إلى لوحة التخفيف ثم تمت إضافة 100 ميكرولتر من خليط الفيروس والأجسام المضادة. يضاف إلى لوحات MDCK. بعد 6 أيام ، تم تثبيت الألواح بنسبة 4٪ فورمالدهيد وتلطيخ بالنافثول الأزرق والأسود كما هو موصوف أعلاه. اعتبرت الآبار سالبة لتكاثر الفيروس إذا كانت الطبقة الأحادية بأكملها سليمة.

NA تحييد مقايسة النسخ المتماثل لفيروس الأجسام المضادة

لدراسة تثبيط الأجسام المضادة وحيدة النسيلة للنمو الفيروسي متعدد الخطوات ، أجريت فحوصات تكاثر الفيروس في وجود الأجسام المضادة وحيدة النسيلة NA أو نمط IgG البشري. تم إصابة MDCKs المتكدسة بـ MOI من .001 كما هو موضح أعلاه. بعد الإصابة ، تمت إزالة اللقاح الفيروسي ، وغسلت الخلايا مرتين باستخدام PBS + وأضيفت الأجسام المضادة أحادية النسيلة (235-1C02 ، 229-1G03 أو IgG استنساخ من النمط IgG البشري IGHG1) عند التركيز المشار إليه في IM الذي يحتوي على 5 ميكروغرام / مل n-Acetyl trypsin. تم تحضين الخلايا المصابة عند 32 درجة مئوية. في كل إصابة بعد نقطة زمنية ، تمت إزالة المادة الطافية وتخزينها في -80 درجة مئوية. عضل جديد مع 5 ميكروغرام / مل N-acetyl trypsin وأضيف الجسم المضاد المشار إليه. تم تحديد العيار الفيروسي عبر TCID50.


شاهد الفيديو: طفرة جديدة من الفيروس التاجي في أوكرانيا (يونيو 2022).


تعليقات:

  1. Teran

    هناك شيء ما في هذا وأعتقد أن هذه فكرة جيدة جدًا. اتفق معك تماما.

  2. Dac Kien

    أخبرني ، من فضلك - أين يمكنني العثور على مزيد من المعلومات حول هذا الموضوع؟

  3. Brakus

    سنتحدث عن هذا الموضوع.

  4. Duer

    الفكرة الممتازة

  5. Moogugis

    يا لها من كلمات جميلة



اكتب رسالة